Incidental Mutation 'R8865:Vmn2r16'
ID 675859
Institutional Source Beutler Lab
Gene Symbol Vmn2r16
Ensembl Gene ENSMUSG00000092080
Gene Name vomeronasal 2, receptor 16
Synonyms EG384220
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109330381-109364481 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109340044 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 261 (I261T)
Ref Sequence ENSEMBL: ENSMUSP00000127838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165180]
AlphaFold A0A3B2WCY4
Predicted Effect probably benign
Transcript: ENSMUST00000165180
AA Change: I261T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127838
Gene: ENSMUSG00000092080
AA Change: I261T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.3e-28 PFAM
Pfam:NCD3G 509 563 8.2e-19 PFAM
Pfam:7tm_3 596 831 3.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Vmn2r16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Vmn2r16 APN 5 109340428 missense probably damaging 1.00
IGL01374:Vmn2r16 APN 5 109330417 missense probably benign 0.00
IGL01391:Vmn2r16 APN 5 109363761 missense possibly damaging 0.50
IGL01419:Vmn2r16 APN 5 109362401 splice site probably benign
IGL01634:Vmn2r16 APN 5 109340311 missense probably benign 0.00
IGL01845:Vmn2r16 APN 5 109363896 missense probably damaging 1.00
IGL01875:Vmn2r16 APN 5 109330411 missense probably benign 0.01
IGL01910:Vmn2r16 APN 5 109340085 missense probably damaging 1.00
IGL02217:Vmn2r16 APN 5 109339810 missense probably damaging 0.98
IGL02327:Vmn2r16 APN 5 109340121 missense probably benign 0.01
IGL02491:Vmn2r16 APN 5 109339837 nonsense probably null
IGL02531:Vmn2r16 APN 5 109340268 missense probably damaging 0.99
IGL02680:Vmn2r16 APN 5 109340082 missense probably benign 0.44
IGL02884:Vmn2r16 APN 5 109360891 missense possibly damaging 0.94
IGL03084:Vmn2r16 APN 5 109330426 missense probably damaging 0.99
IGL03096:Vmn2r16 APN 5 109339885 missense probably damaging 0.99
IGL03355:Vmn2r16 APN 5 109363714 missense possibly damaging 0.74
R0280:Vmn2r16 UTSW 5 109340139 missense possibly damaging 0.88
R0594:Vmn2r16 UTSW 5 109363896 missense probably damaging 1.00
R1016:Vmn2r16 UTSW 5 109339888 missense probably damaging 1.00
R1109:Vmn2r16 UTSW 5 109339786 missense probably damaging 0.98
R1248:Vmn2r16 UTSW 5 109360777 missense probably benign 0.10
R1626:Vmn2r16 UTSW 5 109363577 missense probably damaging 1.00
R1909:Vmn2r16 UTSW 5 109363987 missense probably benign 0.01
R1929:Vmn2r16 UTSW 5 109339258 missense possibly damaging 0.92
R1982:Vmn2r16 UTSW 5 109364024 missense probably benign 0.01
R3038:Vmn2r16 UTSW 5 109339333 missense probably damaging 1.00
R3437:Vmn2r16 UTSW 5 109330496 missense probably damaging 0.99
R3734:Vmn2r16 UTSW 5 109330414 missense probably benign 0.11
R3820:Vmn2r16 UTSW 5 109362277 missense probably benign 0.36
R3873:Vmn2r16 UTSW 5 109340311 missense probably benign 0.33
R4165:Vmn2r16 UTSW 5 109330561 missense possibly damaging 0.80
R4373:Vmn2r16 UTSW 5 109363801 missense probably damaging 1.00
R4575:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4576:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4578:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4637:Vmn2r16 UTSW 5 109330414 missense probably benign 0.00
R4696:Vmn2r16 UTSW 5 109339302 missense probably benign 0.01
R5026:Vmn2r16 UTSW 5 109360856 nonsense probably null
R5180:Vmn2r16 UTSW 5 109330525 missense probably benign 0.01
R5433:Vmn2r16 UTSW 5 109363842 missense probably damaging 1.00
R5955:Vmn2r16 UTSW 5 109363747 missense possibly damaging 0.78
R5958:Vmn2r16 UTSW 5 109362287 missense possibly damaging 0.81
R6353:Vmn2r16 UTSW 5 109340253 missense probably benign 0.33
R6389:Vmn2r16 UTSW 5 109330478 missense probably benign 0.19
R6819:Vmn2r16 UTSW 5 109340546 missense probably benign 0.04
R6994:Vmn2r16 UTSW 5 109340103 missense probably damaging 1.00
R7061:Vmn2r16 UTSW 5 109363754 missense probably damaging 0.99
R7063:Vmn2r16 UTSW 5 109363784 missense probably damaging 1.00
R7220:Vmn2r16 UTSW 5 109360906 missense probably damaging 0.97
R7268:Vmn2r16 UTSW 5 109340465 nonsense probably null
R7420:Vmn2r16 UTSW 5 109363870 missense probably damaging 0.96
R7591:Vmn2r16 UTSW 5 109362357 missense probably damaging 0.99
R7644:Vmn2r16 UTSW 5 109339971 missense probably damaging 1.00
R7939:Vmn2r16 UTSW 5 109339839 missense possibly damaging 0.79
R7977:Vmn2r16 UTSW 5 109340149 missense probably damaging 1.00
R7987:Vmn2r16 UTSW 5 109340149 missense probably damaging 1.00
R8023:Vmn2r16 UTSW 5 109340406 nonsense probably null
R8427:Vmn2r16 UTSW 5 109340272 missense probably benign 0.03
R8436:Vmn2r16 UTSW 5 109363783 missense probably damaging 1.00
R8475:Vmn2r16 UTSW 5 109339207 missense probably benign 0.01
R8554:Vmn2r16 UTSW 5 109364131 missense probably benign 0.13
R8771:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8774:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8774-TAIL:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8775:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8775-TAIL:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8777:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8777-TAIL:Vmn2r16 UTSW 5 109340365 missense probably benign 0.00
R8825:Vmn2r16 UTSW 5 109339153 missense probably benign 0.41
R8900:Vmn2r16 UTSW 5 109363753 missense probably benign 0.04
R9365:Vmn2r16 UTSW 5 109340198 missense probably damaging 0.99
R9683:Vmn2r16 UTSW 5 109363811 missense probably damaging 1.00
X0027:Vmn2r16 UTSW 5 109339309 missense probably damaging 1.00
Z1088:Vmn2r16 UTSW 5 109340515 missense probably benign 0.03
Z1088:Vmn2r16 UTSW 5 109363913 frame shift probably null
Z1177:Vmn2r16 UTSW 5 109339998 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GACACACATTTGTCCCATGCC -3'
(R):5'- TGGGCAAATGTGATAGTCCCATG -3'

Sequencing Primer
(F):5'- ATGCCATGGTCTCCTTGATG -3'
(R):5'- TGTGATAGTCCCATGGAAGAAATC -3'
Posted On 2021-07-15