Incidental Mutation 'R0731:Ripor2'
ID 67586
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene Name RHO family interacting cell polarization regulator 2
Synonyms 1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R0731 (G1)
Quality Score 188
Status Validated
Chromosome 13
Chromosomal Location 24685513-24917789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24864627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 219 (E219V)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
AlphaFold Q80U16
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: E219V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058009
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: E219V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: E222V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: E222V

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: E194V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: E194V

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: E219V

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177174
Meta Mutation Damage Score 0.9405 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24,885,190 (GRCm39) missense probably benign 0.11
IGL02145:Ripor2 APN 13 24,901,554 (GRCm39) missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24,915,572 (GRCm39) missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24,879,549 (GRCm39) splice site probably benign
IGL02533:Ripor2 APN 13 24,885,378 (GRCm39) nonsense probably null
IGL02798:Ripor2 APN 13 24,858,649 (GRCm39) missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24,879,681 (GRCm39) missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24,880,512 (GRCm39) missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24,907,702 (GRCm39) missense probably damaging 1.00
gentleman UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
Jack UTSW 13 24,861,824 (GRCm39) nonsense probably null
whitechapel UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R0045:Ripor2 UTSW 13 24,878,209 (GRCm39) missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24,864,615 (GRCm39) missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24,878,169 (GRCm39) missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24,861,824 (GRCm39) nonsense probably null
R1374:Ripor2 UTSW 13 24,857,095 (GRCm39) critical splice donor site probably null
R1564:Ripor2 UTSW 13 24,859,768 (GRCm39) missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24,885,237 (GRCm39) missense probably benign 0.10
R1889:Ripor2 UTSW 13 24,877,870 (GRCm39) missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24,897,701 (GRCm39) missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24,905,817 (GRCm39) critical splice donor site probably null
R2209:Ripor2 UTSW 13 24,885,595 (GRCm39) missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24,855,755 (GRCm39) missense probably benign 0.08
R2392:Ripor2 UTSW 13 24,890,206 (GRCm39) missense probably benign 0.00
R2994:Ripor2 UTSW 13 24,885,610 (GRCm39) missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24,880,521 (GRCm39) missense probably benign
R4287:Ripor2 UTSW 13 24,908,992 (GRCm39) missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4365:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4366:Ripor2 UTSW 13 24,905,694 (GRCm39) missense probably benign 0.07
R4868:Ripor2 UTSW 13 24,878,124 (GRCm39) missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24,858,649 (GRCm39) missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24,798,627 (GRCm39) start gained probably benign
R6157:Ripor2 UTSW 13 24,885,052 (GRCm39) missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24,894,113 (GRCm39) missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24,861,828 (GRCm39) missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24,859,803 (GRCm39) missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24,890,215 (GRCm39) missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24,855,829 (GRCm39) missense probably benign 0.00
R7041:Ripor2 UTSW 13 24,877,749 (GRCm39) missense probably benign 0.18
R7196:Ripor2 UTSW 13 24,888,808 (GRCm39) missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24,855,886 (GRCm39) missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24,878,128 (GRCm39) missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24,908,984 (GRCm39) missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24,885,427 (GRCm39) nonsense probably null
R7417:Ripor2 UTSW 13 24,880,533 (GRCm39) missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24,878,188 (GRCm39) missense probably benign 0.01
R7448:Ripor2 UTSW 13 24,854,054 (GRCm39) missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24,880,290 (GRCm39) missense unknown
R7499:Ripor2 UTSW 13 24,877,755 (GRCm39) missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24,897,683 (GRCm39) missense probably benign 0.01
R8157:Ripor2 UTSW 13 24,879,600 (GRCm39) missense probably benign 0.05
R8364:Ripor2 UTSW 13 24,894,176 (GRCm39) missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24,907,771 (GRCm39) missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24,849,451 (GRCm39) intron probably benign
R8751:Ripor2 UTSW 13 24,885,050 (GRCm39) missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24,901,651 (GRCm39) missense possibly damaging 0.93
R8867:Ripor2 UTSW 13 24,822,760 (GRCm39) intron probably benign
R9079:Ripor2 UTSW 13 24,915,637 (GRCm39) missense probably benign 0.35
R9187:Ripor2 UTSW 13 24,897,632 (GRCm39) missense probably benign 0.01
R9316:Ripor2 UTSW 13 24,905,719 (GRCm39) missense probably benign 0.09
R9320:Ripor2 UTSW 13 24,915,663 (GRCm39) missense probably damaging 1.00
R9355:Ripor2 UTSW 13 24,885,694 (GRCm39) missense probably benign 0.00
R9655:Ripor2 UTSW 13 24,908,983 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCTAACTTGTCCACCTAAGCCCCAG -3'
(R):5'- ACCATTTTCAAATGCGAAGGCAAGG -3'

Sequencing Primer
(F):5'- TATCCCATGCACCCGGAG -3'
(R):5'- AAGGTACAAGAAGAGACCCATC -3'
Posted On 2013-09-03