Mutagenetix > Incidental Mutation

Incidental Mutation 'R0731:Ripor2'

67586

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik

MMRRC Submission

038912-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R0731 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

24582189-24733816 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24680644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 219 (E219V)

Ref Sequence

ENSEMBL: ENSMUSP00000106013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]

AlphaFold

Q80U16

Predicted Effect

probably damaging
Transcript: ENSMUST00000038477
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: E219V

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC
low complexity region	461	476	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000058009
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: E219V

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000091694
AA Change: E222V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: E222V

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
coiled coil region	111	140	N/A	INTRINSIC
low complexity region	422	437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110383
AA Change: E194V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: E194V

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110384
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: E219V

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177174

Meta Mutation Damage Score

0.9405

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24701207	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24717571	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24695566	splice site	probably benign
IGL02533:Ripor2	APN	13	24701395	nonsense	probably null
IGL02798:Ripor2	APN	13	24674666	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24695698	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24696529	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24723719	missense	probably damaging	1.00
gentleman	UTSW	13	24694145	missense	probably damaging	1.00
Jack	UTSW	13	24677841	nonsense	probably null
whitechapel	UTSW	13	24673112	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24694226	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24680632	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24694186	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24677841	nonsense	probably null
R1374:Ripor2	UTSW	13	24673112	critical splice donor site	probably null
R1564:Ripor2	UTSW	13	24675785	missense	probably damaging	1.00
R1773:Ripor2	UTSW	13	24701254	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24693887	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24713718	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24721834	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24701612	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24671772	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24706223	missense	probably benign	0.00
R2994:Ripor2	UTSW	13	24701627	missense	probably damaging	0.98
R4008:Ripor2	UTSW	13	24696538	missense	probably benign
R4287:Ripor2	UTSW	13	24725009	missense	probably damaging	1.00
R4364:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4365:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24694141	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24674666	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24614644	start gained	probably benign
R6157:Ripor2	UTSW	13	24701069	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24710130	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24677845	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24675820	missense	probably damaging	0.98
R6908:Ripor2	UTSW	13	24706232	missense	probably damaging	1.00
R7023:Ripor2	UTSW	13	24671846	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24693766	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24704825	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24671903	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24694145	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24701444	nonsense	probably null
R7417:Ripor2	UTSW	13	24696550	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24694205	missense	probably benign	0.01
R7448:Ripor2	UTSW	13	24670071	missense	possibly damaging	0.71
R7462:Ripor2	UTSW	13	24696307	missense	unknown
R7499:Ripor2	UTSW	13	24693772	missense	probably damaging	0.99
R8081:Ripor2	UTSW	13	24713700	missense	probably benign	0.01
R8157:Ripor2	UTSW	13	24695617	missense	probably benign	0.05
R8364:Ripor2	UTSW	13	24710193	missense	possibly damaging	0.95
R8447:Ripor2	UTSW	13	24723788	missense	probably damaging	1.00
R8465:Ripor2	UTSW	13	24665468	intron	probably benign
R8751:Ripor2	UTSW	13	24701067	missense	possibly damaging	0.69
R8818:Ripor2	UTSW	13	24717668	missense	possibly damaging	0.93
R8867:Ripor2	UTSW	13	24638777	intron	probably benign
R9079:Ripor2	UTSW	13	24731654	missense	probably benign	0.35
R9187:Ripor2	UTSW	13	24713649	missense	probably benign	0.01
R9316:Ripor2	UTSW	13	24721736	missense	probably benign	0.09
R9320:Ripor2	UTSW	13	24731680	missense	probably damaging	1.00
R9355:Ripor2	UTSW	13	24701711	missense	probably benign	0.00
R9655:Ripor2	UTSW	13	24725000	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TCTAACTTGTCCACCTAAGCCCCAG -3'
(R):5'- ACCATTTTCAAATGCGAAGGCAAGG -3'

Sequencing Primer
(F):5'- TATCCCATGCACCCGGAG -3'
(R):5'- AAGGTACAAGAAGAGACCCATC -3'

Posted On

2013-09-03