Incidental Mutation 'R0731:Ripor2'
ID67586
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0731 (G1)
Quality Score188
Status Validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24680644 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 219 (E219V)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: E219V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058009
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: E219V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: E222V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: E222V

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: E194V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: E194V

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: E219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: E219V

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177174
Meta Mutation Damage Score 0.9405 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Wfikkn1 T A 17: 25,878,017 R444S probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACTTGTCCACCTAAGCCCCAG -3'
(R):5'- ACCATTTTCAAATGCGAAGGCAAGG -3'

Sequencing Primer
(F):5'- TATCCCATGCACCCGGAG -3'
(R):5'- AAGGTACAAGAAGAGACCCATC -3'
Posted On2013-09-03