Mutagenetix > Incidental Mutation

Incidental Mutation 'R8865:Chl1'

675863

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R8865 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103708861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 898 (K898E)

Ref Sequence

ENSEMBL: ENSMUSP00000063933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

AlphaFold

P70232

Predicted Effect

probably damaging
Transcript: ENSMUST00000066905
AA Change: K898E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: K898E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203830
AA Change: K898E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: K898E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203912
AA Change: K914E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: K914E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077
AA Change: K171E

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	T	A	11: 50,781,744	Y606*	probably null	Het
Adgrb1	A	G	15: 74,543,658	I696V	possibly damaging	Het
Ass1	A	G	2: 31,520,395	Q406R	probably benign	Het
Calcoco2	GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC	GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC	11: 96,099,982		probably benign	Het
Ccdc148	T	C	2: 58,829,820	K409R	possibly damaging	Het
Ccnl1	A	T	3: 65,946,848	S451T	probably benign	Het
Cdc123	T	C	2: 5,795,424		probably benign	Het
Cep192	T	C	18: 67,834,632	V729A	probably benign	Het
Chd6	G	A	2: 161,021,069	A444V	probably benign	Het
Chrng	T	C	1: 87,207,497	V154A	probably damaging	Het
Cog1	T	G	11: 113,658,498	M799R	probably benign	Het
Col4a3	G	A	1: 82,669,762		probably null	Het
Coro6	C	A	11: 77,469,091	T366K	probably damaging	Het
Cwh43	G	A	5: 73,441,359	M640I	probably benign	Het
Cyp2c55	A	G	19: 39,031,434	E272G	probably benign	Het
Cyp4f39	A	G	17: 32,483,297	Y256C	probably damaging	Het
Dbx2	G	A	15: 95,632,400	R229*	probably null	Het
Dcdc2a	C	T	13: 25,202,283	A380V	probably benign	Het
En1	G	T	1: 120,603,000		probably benign	Het
F3	T	A	3: 121,729,411	V90E	probably damaging	Het
Fam171a1	A	G	2: 3,225,903	K691R	probably damaging	Het
Foxp2	C	T	6: 15,415,094	A609V	unknown	Het
Hemgn	A	T	4: 46,396,682	S185T	possibly damaging	Het
Hk1	C	T	10: 62,315,515	D33N	probably benign	Het
Igfbp1	T	A	11: 7,201,929	V244D	probably damaging	Het
Insr	A	T	8: 3,161,358	D1160E	probably damaging	Het
Irs1	A	T	1: 82,288,109	Y795*	probably null	Het
Krtap28-10	T	C	1: 83,042,087	K111E	unknown	Het
Lbx1	T	G	19: 45,235,166	D21A	probably benign	Het
Map6	G	T	7: 99,268,985	A322S	probably benign	Het
Mat1a	T	C	14: 41,121,831	Y336H	probably damaging	Het
Mcf2l	A	G	8: 12,880,003	I8V	probably benign	Het
Med12l	T	C	3: 59,071,882	V276A	probably benign	Het
Mettl17	A	G	14: 51,884,851		probably benign	Het
Mllt1	T	C	17: 56,900,295	D183G	possibly damaging	Het
Msmb	T	A	14: 32,150,260	C69*	probably null	Het
Mterf1a	A	G	5: 3,891,425	S148P	probably damaging	Het
Mybl2	A	G	2: 163,080,733	I583V	probably benign	Het
Nbr1	T	A	11: 101,564,694	D91E	probably benign	Het
Notch3	A	G	17: 32,122,116	Y2221H	probably benign	Het
Npat	C	A	9: 53,570,640	T1216N	probably benign	Het
Olfr1082	C	A	2: 86,594,400	V143F	possibly damaging	Het
Olfr127	T	C	17: 37,904,224	L226P	probably damaging	Het
Olfr137	T	A	17: 38,304,981	H160L	probably damaging	Het
Pawr	T	A	10: 108,382,742	Y170N	probably damaging	Het
Pde12	T	C	14: 26,669,125	D143G	possibly damaging	Het
Phactr2	A	G	10: 13,253,732	I264T	probably benign	Het
Pip5k1b	A	G	19: 24,397,058	L53P	probably damaging	Het
Pknox1	T	C	17: 31,599,546	I251T	probably benign	Het
Plcxd1	A	T	5: 110,101,975		probably benign	Het
Polr3c	C	T	3: 96,715,201		probably benign	Het
Ppil2	T	C	16: 17,097,405	N113S	probably benign	Het
Pramel4	G	C	4: 144,068,482	G483R	probably damaging	Het
Prdm10	T	C	9: 31,327,397	L195P	probably damaging	Het
Prss16	A	T	13: 22,003,005	L465Q	possibly damaging	Het
Psg25	G	T	7: 18,529,594	H101Q	possibly damaging	Het
Pstpip2	A	G	18: 77,846,408	D55G	possibly damaging	Het
Rfc1	A	T	5: 65,278,792	D636E	possibly damaging	Het
Scarf2	G	T	16: 17,803,110	C214F	probably damaging	Het
Sirt4	T	C	5: 115,482,645	E156G	probably damaging	Het
Spag6	C	T	2: 18,734,117	S286L	probably benign	Het
Stx17	T	A	4: 48,183,444	H267Q	unknown	Het
Tekt3	T	C	11: 63,070,232	C76R	probably benign	Het
Tln1	A	T	4: 43,538,281	V1807E	possibly damaging	Het
Tnfrsf21	A	G	17: 43,085,481	D552G	probably damaging	Het
Ttn	C	A	2: 76,730,320	V29246L	possibly damaging	Het
Usp43	C	A	11: 67,898,962	C252F	probably damaging	Het
Vmn2r16	T	C	5: 109,340,044	I261T	probably benign	Het
Vwa5b1	T	C	4: 138,581,219	E769G	probably benign	Het
Xrn1	T	A	9: 95,991,193	F670Y	probably benign	Het
Zc3h7b	G	A	15: 81,772,480	R166Q	probably benign	Het
Zdhhc14	A	T	17: 5,725,295	Y274F	possibly damaging	Het
Zeb2	T	A	2: 44,996,127	M973L	probably benign	Het
Zfp638	T	C	6: 83,977,053	V1380A	possibly damaging	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
R8462:Chl1	UTSW	6	103729169	missense	probably benign	0.11
R8558:Chl1	UTSW	6	103708429	missense	probably benign	0.14
R8827:Chl1	UTSW	6	103693150	missense	probably benign
R8939:Chl1	UTSW	6	103665907	missense	probably damaging	1.00
R9092:Chl1	UTSW	6	103668854	unclassified	probably benign
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign
Z1191:Chl1	UTSW	6	103683211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGGTTTGCCTTTTCATTGC -3'
(R):5'- ACCTTGAGAAAACTTGGTTGTTCAG -3'

Sequencing Primer
(F):5'- GCCTTTTCATTGCAGATAAATTGGTG -3'
(R):5'- GGTTGTTCAGGTACTAGAAAACAC -3'

Posted On

2021-07-15