Incidental Mutation 'R8865:Insr'
ID 675866
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Name insulin receptor
Synonyms IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3122061-3279617 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3161358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1160 (D1160E)
Ref Sequence ENSEMBL: ENSMUSP00000088837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291]
AlphaFold P15208
PDB Structure 1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000091291
AA Change: D1160E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: D1160E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208839
Meta Mutation Damage Score 0.2845 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3258682 missense probably damaging 1.00
IGL01986:Insr APN 8 3158817 missense probably damaging 1.00
IGL02135:Insr APN 8 3258741 missense probably damaging 1.00
IGL02203:Insr APN 8 3155817 missense probably benign 0.18
IGL02220:Insr APN 8 3159578 missense probably damaging 1.00
IGL02678:Insr APN 8 3173570 missense probably benign 0.00
IGL02961:Insr APN 8 3258785 missense probably benign 0.08
IGL03099:Insr APN 8 3258715 missense probably damaging 1.00
IGL03125:Insr APN 8 3184972 missense possibly damaging 0.87
IGL03290:Insr APN 8 3258574 missense probably damaging 1.00
gummi_bear UTSW 8 3161770 missense probably damaging 1.00
jellybelly UTSW 8 3258841 missense probably damaging 1.00
Patently UTSW 8 3159475 missense probably damaging 1.00
trolli UTSW 8 3198111 missense probably benign 0.31
R0047:Insr UTSW 8 3202947 missense probably damaging 0.97
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0053:Insr UTSW 8 3155683 missense probably damaging 1.00
R0480:Insr UTSW 8 3161770 missense probably damaging 1.00
R0748:Insr UTSW 8 3258841 missense probably damaging 1.00
R0919:Insr UTSW 8 3158769 missense probably damaging 1.00
R1348:Insr UTSW 8 3192635 missense probably damaging 1.00
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1467:Insr UTSW 8 3169720 missense probably damaging 0.99
R1568:Insr UTSW 8 3165576 missense probably benign
R1768:Insr UTSW 8 3159561 missense probably damaging 1.00
R2093:Insr UTSW 8 3204762 missense probably damaging 1.00
R2111:Insr UTSW 8 3169748 missense probably benign 0.17
R2112:Insr UTSW 8 3169748 missense probably benign 0.17
R2352:Insr UTSW 8 3192593 missense probably damaging 1.00
R2364:Insr UTSW 8 3174820 missense probably benign
R2842:Insr UTSW 8 3202986 missense probably damaging 1.00
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R3162:Insr UTSW 8 3161416 missense possibly damaging 0.65
R4081:Insr UTSW 8 3211391 missense probably benign 0.00
R4441:Insr UTSW 8 3194902 missense probably benign 0.00
R4672:Insr UTSW 8 3167501 critical splice donor site probably null
R4687:Insr UTSW 8 3161709 missense probably benign 0.42
R4708:Insr UTSW 8 3211346 intron probably benign
R4890:Insr UTSW 8 3198234 missense probably benign 0.16
R4949:Insr UTSW 8 3185059 missense probably benign 0.04
R4996:Insr UTSW 8 3192665 missense probably null 0.98
R5073:Insr UTSW 8 3159475 missense probably damaging 1.00
R5176:Insr UTSW 8 3158742 missense probably benign 0.03
R5200:Insr UTSW 8 3198059 critical splice donor site probably null
R5323:Insr UTSW 8 3202902 missense probably benign 0.02
R5453:Insr UTSW 8 3155694 missense probably benign 0.06
R5516:Insr UTSW 8 3155764 nonsense probably null
R5704:Insr UTSW 8 3185122 missense possibly damaging 0.52
R5820:Insr UTSW 8 3155976 missense probably damaging 1.00
R5879:Insr UTSW 8 3198173 nonsense probably null
R5894:Insr UTSW 8 3174869 missense possibly damaging 0.88
R5937:Insr UTSW 8 3174808 missense probably benign
R5966:Insr UTSW 8 3258697 missense probably benign 0.04
R6134:Insr UTSW 8 3192572 missense probably damaging 1.00
R6352:Insr UTSW 8 3173479 critical splice donor site probably null
R6423:Insr UTSW 8 3173566 missense probably benign
R6687:Insr UTSW 8 3198111 missense probably benign 0.31
R6985:Insr UTSW 8 3161372 missense possibly damaging 0.87
R6993:Insr UTSW 8 3258752 missense probably damaging 1.00
R7041:Insr UTSW 8 3258418 missense probably benign
R7109:Insr UTSW 8 3258481 missense probably benign 0.33
R7216:Insr UTSW 8 3203034 missense possibly damaging 0.53
R7287:Insr UTSW 8 3169717 missense probably benign 0.00
R7378:Insr UTSW 8 3198231 missense probably damaging 1.00
R7525:Insr UTSW 8 3192642 missense probably damaging 1.00
R7572:Insr UTSW 8 3173602 missense probably benign 0.11
R7636:Insr UTSW 8 3258709 missense probably damaging 1.00
R7684:Insr UTSW 8 3169753 missense possibly damaging 0.85
R7840:Insr UTSW 8 3258415 missense probably benign 0.04
R8075:Insr UTSW 8 3155862 missense probably benign 0.17
R8161:Insr UTSW 8 3258660 missense probably damaging 1.00
R8220:Insr UTSW 8 3158702 missense probably benign 0.01
R8434:Insr UTSW 8 3165514 splice site probably benign
R8810:Insr UTSW 8 3169714 missense probably benign
R8884:Insr UTSW 8 3155679 missense probably benign
R9134:Insr UTSW 8 3258413 missense probably damaging 1.00
R9359:Insr UTSW 8 3158717 missense probably damaging 1.00
R9407:Insr UTSW 8 3185106 missense probably benign
R9647:Insr UTSW 8 3155874 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTAGGACCCAAGAATCTGCC -3'
(R):5'- AGATGGAATCAGAGTGCTAATTGC -3'

Sequencing Primer
(F):5'- GACCCAAGAATCTGCCATGCC -3'
(R):5'- AATTGCAACCCCTGTTTTGACTTTAG -3'
Posted On 2021-07-15