Incidental Mutation 'R8865:Insr'
ID 675866
Institutional Source Beutler Lab
Gene Symbol Insr
Ensembl Gene ENSMUSG00000005534
Gene Name insulin receptor
Synonyms 4932439J01Rik, D630014A15Rik, IR, IR-B, IR-A, CD220
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.879) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3200922-3329649 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 3211358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1160 (D1160E)
Ref Sequence ENSEMBL: ENSMUSP00000088837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091291]
AlphaFold P15208
PDB Structure 1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000091291
AA Change: D1160E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: D1160E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Recep_L_domain 52 164 5e-28 PFAM
FU 231 274 1.66e-10 SMART
Pfam:Recep_L_domain 359 473 2.5e-30 PFAM
FN3 496 602 4.02e1 SMART
FN3 624 821 1.16e-6 SMART
FN3 841 924 3.17e-4 SMART
transmembrane domain 947 969 N/A INTRINSIC
TyrKc 1013 1280 3.11e-134 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1327 1336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208839
Meta Mutation Damage Score 0.2845 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Adgrb1 A G 15: 74,415,507 (GRCm39) I696V possibly damaging Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Cep192 T C 18: 67,967,703 (GRCm39) V729A probably benign Het
Chd6 G A 2: 160,862,989 (GRCm39) A444V probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or14j6 T C 17: 38,215,115 (GRCm39) L226P probably damaging Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Ypel1 T C 16: 16,915,269 (GRCm39) N113S probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Insr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Insr APN 8 3,308,682 (GRCm39) missense probably damaging 1.00
IGL01986:Insr APN 8 3,208,817 (GRCm39) missense probably damaging 1.00
IGL02135:Insr APN 8 3,308,741 (GRCm39) missense probably damaging 1.00
IGL02203:Insr APN 8 3,205,817 (GRCm39) missense probably benign 0.18
IGL02220:Insr APN 8 3,209,578 (GRCm39) missense probably damaging 1.00
IGL02678:Insr APN 8 3,223,570 (GRCm39) missense probably benign 0.00
IGL02961:Insr APN 8 3,308,785 (GRCm39) missense probably benign 0.08
IGL03099:Insr APN 8 3,308,715 (GRCm39) missense probably damaging 1.00
IGL03125:Insr APN 8 3,234,972 (GRCm39) missense possibly damaging 0.87
IGL03290:Insr APN 8 3,308,574 (GRCm39) missense probably damaging 1.00
gummi_bear UTSW 8 3,211,770 (GRCm39) missense probably damaging 1.00
jellybelly UTSW 8 3,308,841 (GRCm39) missense probably damaging 1.00
Patently UTSW 8 3,209,475 (GRCm39) missense probably damaging 1.00
trolli UTSW 8 3,248,111 (GRCm39) missense probably benign 0.31
R0047:Insr UTSW 8 3,252,947 (GRCm39) missense probably damaging 0.97
R0053:Insr UTSW 8 3,205,683 (GRCm39) missense probably damaging 1.00
R0053:Insr UTSW 8 3,205,683 (GRCm39) missense probably damaging 1.00
R0480:Insr UTSW 8 3,211,770 (GRCm39) missense probably damaging 1.00
R0748:Insr UTSW 8 3,308,841 (GRCm39) missense probably damaging 1.00
R0919:Insr UTSW 8 3,208,769 (GRCm39) missense probably damaging 1.00
R1348:Insr UTSW 8 3,242,635 (GRCm39) missense probably damaging 1.00
R1467:Insr UTSW 8 3,219,720 (GRCm39) missense probably damaging 0.99
R1467:Insr UTSW 8 3,219,720 (GRCm39) missense probably damaging 0.99
R1568:Insr UTSW 8 3,215,576 (GRCm39) missense probably benign
R1768:Insr UTSW 8 3,209,561 (GRCm39) missense probably damaging 1.00
R2093:Insr UTSW 8 3,254,762 (GRCm39) missense probably damaging 1.00
R2111:Insr UTSW 8 3,219,748 (GRCm39) missense probably benign 0.17
R2112:Insr UTSW 8 3,219,748 (GRCm39) missense probably benign 0.17
R2352:Insr UTSW 8 3,242,593 (GRCm39) missense probably damaging 1.00
R2364:Insr UTSW 8 3,224,820 (GRCm39) missense probably benign
R2842:Insr UTSW 8 3,252,986 (GRCm39) missense probably damaging 1.00
R3162:Insr UTSW 8 3,211,416 (GRCm39) missense possibly damaging 0.65
R3162:Insr UTSW 8 3,211,416 (GRCm39) missense possibly damaging 0.65
R4081:Insr UTSW 8 3,261,391 (GRCm39) missense probably benign 0.00
R4441:Insr UTSW 8 3,244,902 (GRCm39) missense probably benign 0.00
R4672:Insr UTSW 8 3,217,501 (GRCm39) critical splice donor site probably null
R4687:Insr UTSW 8 3,211,709 (GRCm39) missense probably benign 0.42
R4708:Insr UTSW 8 3,261,346 (GRCm39) intron probably benign
R4890:Insr UTSW 8 3,248,234 (GRCm39) missense probably benign 0.16
R4949:Insr UTSW 8 3,235,059 (GRCm39) missense probably benign 0.04
R4996:Insr UTSW 8 3,242,665 (GRCm39) missense probably null 0.98
R5073:Insr UTSW 8 3,209,475 (GRCm39) missense probably damaging 1.00
R5176:Insr UTSW 8 3,208,742 (GRCm39) missense probably benign 0.03
R5200:Insr UTSW 8 3,248,059 (GRCm39) critical splice donor site probably null
R5323:Insr UTSW 8 3,252,902 (GRCm39) missense probably benign 0.02
R5453:Insr UTSW 8 3,205,694 (GRCm39) missense probably benign 0.06
R5516:Insr UTSW 8 3,205,764 (GRCm39) nonsense probably null
R5704:Insr UTSW 8 3,235,122 (GRCm39) missense possibly damaging 0.52
R5820:Insr UTSW 8 3,205,976 (GRCm39) missense probably damaging 1.00
R5879:Insr UTSW 8 3,248,173 (GRCm39) nonsense probably null
R5894:Insr UTSW 8 3,224,869 (GRCm39) missense possibly damaging 0.88
R5937:Insr UTSW 8 3,224,808 (GRCm39) missense probably benign
R5966:Insr UTSW 8 3,308,697 (GRCm39) missense probably benign 0.04
R6134:Insr UTSW 8 3,242,572 (GRCm39) missense probably damaging 1.00
R6352:Insr UTSW 8 3,223,479 (GRCm39) critical splice donor site probably null
R6423:Insr UTSW 8 3,223,566 (GRCm39) missense probably benign
R6687:Insr UTSW 8 3,248,111 (GRCm39) missense probably benign 0.31
R6985:Insr UTSW 8 3,211,372 (GRCm39) missense possibly damaging 0.87
R6993:Insr UTSW 8 3,308,752 (GRCm39) missense probably damaging 1.00
R7041:Insr UTSW 8 3,308,418 (GRCm39) missense probably benign
R7109:Insr UTSW 8 3,308,481 (GRCm39) missense probably benign 0.33
R7216:Insr UTSW 8 3,253,034 (GRCm39) missense possibly damaging 0.53
R7287:Insr UTSW 8 3,219,717 (GRCm39) missense probably benign 0.00
R7378:Insr UTSW 8 3,248,231 (GRCm39) missense probably damaging 1.00
R7525:Insr UTSW 8 3,242,642 (GRCm39) missense probably damaging 1.00
R7572:Insr UTSW 8 3,223,602 (GRCm39) missense probably benign 0.11
R7636:Insr UTSW 8 3,308,709 (GRCm39) missense probably damaging 1.00
R7684:Insr UTSW 8 3,219,753 (GRCm39) missense possibly damaging 0.85
R7840:Insr UTSW 8 3,308,415 (GRCm39) missense probably benign 0.04
R8075:Insr UTSW 8 3,205,862 (GRCm39) missense probably benign 0.17
R8161:Insr UTSW 8 3,308,660 (GRCm39) missense probably damaging 1.00
R8220:Insr UTSW 8 3,208,702 (GRCm39) missense probably benign 0.01
R8434:Insr UTSW 8 3,215,514 (GRCm39) splice site probably benign
R8810:Insr UTSW 8 3,219,714 (GRCm39) missense probably benign
R8884:Insr UTSW 8 3,205,679 (GRCm39) missense probably benign
R9134:Insr UTSW 8 3,308,413 (GRCm39) missense probably damaging 1.00
R9359:Insr UTSW 8 3,208,717 (GRCm39) missense probably damaging 1.00
R9407:Insr UTSW 8 3,235,106 (GRCm39) missense probably benign
R9647:Insr UTSW 8 3,205,874 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTAGGACCCAAGAATCTGCC -3'
(R):5'- AGATGGAATCAGAGTGCTAATTGC -3'

Sequencing Primer
(F):5'- GACCCAAGAATCTGCCATGCC -3'
(R):5'- AATTGCAACCCCTGTTTTGACTTTAG -3'
Posted On 2021-07-15