Incidental Mutation 'R0731:Gpr137c'
ID 67588
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene Name G protein-coupled receptor 137C
Synonyms TM7SF1L2, LOC380893, 6330416L11Rik
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0731 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 45457174-45520182 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45483806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 178 (C178S)
Ref Sequence ENSEMBL: ENSMUSP00000120015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146150]
AlphaFold E9Q343
Predicted Effect probably damaging
Transcript: ENSMUST00000146150
AA Change: C178S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092
AA Change: C178S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Meta Mutation Damage Score 0.3771 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45,516,202 (GRCm39) missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45,517,412 (GRCm39) missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45,514,944 (GRCm39) missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45,483,890 (GRCm39) missense possibly damaging 0.92
R1162:Gpr137c UTSW 14 45,481,615 (GRCm39) missense possibly damaging 0.89
R1245:Gpr137c UTSW 14 45,516,522 (GRCm39) utr 3 prime probably benign
R1983:Gpr137c UTSW 14 45,517,428 (GRCm39) missense probably benign 0.01
R2060:Gpr137c UTSW 14 45,481,616 (GRCm39) missense probably damaging 1.00
R2428:Gpr137c UTSW 14 45,516,420 (GRCm39) missense probably damaging 1.00
R3034:Gpr137c UTSW 14 45,457,733 (GRCm39) missense probably damaging 0.99
R3911:Gpr137c UTSW 14 45,516,392 (GRCm39) missense probably benign 0.31
R4037:Gpr137c UTSW 14 45,457,687 (GRCm39) missense probably damaging 0.99
R4038:Gpr137c UTSW 14 45,457,687 (GRCm39) missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45,483,965 (GRCm39) missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45,483,743 (GRCm39) critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45,516,151 (GRCm39) missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45,514,938 (GRCm39) missense probably damaging 0.96
R7117:Gpr137c UTSW 14 45,516,484 (GRCm39) missense probably damaging 1.00
R7238:Gpr137c UTSW 14 45,516,148 (GRCm39) missense probably damaging 1.00
R7365:Gpr137c UTSW 14 45,516,471 (GRCm39) missense probably damaging 1.00
R9515:Gpr137c UTSW 14 45,516,229 (GRCm39) nonsense probably null
R9539:Gpr137c UTSW 14 45,516,187 (GRCm39) missense probably damaging 0.97
X0027:Gpr137c UTSW 14 45,516,126 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCCCATAATGGTGTTAAAATGGCTCAA -3'
(R):5'- TGATTCGAGGTAGACATTTGCTGATGAC -3'

Sequencing Primer
(F):5'- tcctcccactcccacttc -3'
(R):5'- GTAGACATTTGCTGATGACATTTTTG -3'
Posted On 2013-09-03