Mutagenetix > Incidental Mutation

Incidental Mutation 'R8865:Adgrb1'

675888

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

Bai1, B830018M07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8865 (G1)

Quality Score

210.009

Status

Validated

Chromosome

Chromosomal Location

74516195-74589465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74543658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 696 (I696V)

Ref Sequence

ENSEMBL: ENSMUSP00000046097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042035
AA Change: I696V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: I696V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186360
AA Change: I696V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: I696V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Meta Mutation Damage Score

0.1356

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	T	A	11: 50,781,744	Y606*	probably null	Het
Ass1	A	G	2: 31,520,395	Q406R	probably benign	Het
Calcoco2	GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC	GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC	11: 96,099,982		probably benign	Het
Ccdc148	T	C	2: 58,829,820	K409R	possibly damaging	Het
Ccnl1	A	T	3: 65,946,848	S451T	probably benign	Het
Cdc123	T	C	2: 5,795,424		probably benign	Het
Cep192	T	C	18: 67,834,632	V729A	probably benign	Het
Chd6	G	A	2: 161,021,069	A444V	probably benign	Het
Chl1	A	G	6: 103,708,861	K898E	probably damaging	Het
Chrng	T	C	1: 87,207,497	V154A	probably damaging	Het
Cog1	T	G	11: 113,658,498	M799R	probably benign	Het
Col4a3	G	A	1: 82,669,762		probably null	Het
Coro6	C	A	11: 77,469,091	T366K	probably damaging	Het
Cwh43	G	A	5: 73,441,359	M640I	probably benign	Het
Cyp2c55	A	G	19: 39,031,434	E272G	probably benign	Het
Cyp4f39	A	G	17: 32,483,297	Y256C	probably damaging	Het
Dbx2	G	A	15: 95,632,400	R229*	probably null	Het
Dcdc2a	C	T	13: 25,202,283	A380V	probably benign	Het
En1	G	T	1: 120,603,000		probably benign	Het
F3	T	A	3: 121,729,411	V90E	probably damaging	Het
Fam171a1	A	G	2: 3,225,903	K691R	probably damaging	Het
Foxp2	C	T	6: 15,415,094	A609V	unknown	Het
Hemgn	A	T	4: 46,396,682	S185T	possibly damaging	Het
Hk1	C	T	10: 62,315,515	D33N	probably benign	Het
Igfbp1	T	A	11: 7,201,929	V244D	probably damaging	Het
Insr	A	T	8: 3,161,358	D1160E	probably damaging	Het
Irs1	A	T	1: 82,288,109	Y795*	probably null	Het
Krtap28-10	T	C	1: 83,042,087	K111E	unknown	Het
Lbx1	T	G	19: 45,235,166	D21A	probably benign	Het
Map6	G	T	7: 99,268,985	A322S	probably benign	Het
Mat1a	T	C	14: 41,121,831	Y336H	probably damaging	Het
Mcf2l	A	G	8: 12,880,003	I8V	probably benign	Het
Med12l	T	C	3: 59,071,882	V276A	probably benign	Het
Mettl17	A	G	14: 51,884,851		probably benign	Het
Mllt1	T	C	17: 56,900,295	D183G	possibly damaging	Het
Msmb	T	A	14: 32,150,260	C69*	probably null	Het
Mterf1a	A	G	5: 3,891,425	S148P	probably damaging	Het
Mybl2	A	G	2: 163,080,733	I583V	probably benign	Het
Nbr1	T	A	11: 101,564,694	D91E	probably benign	Het
Notch3	A	G	17: 32,122,116	Y2221H	probably benign	Het
Npat	C	A	9: 53,570,640	T1216N	probably benign	Het
Olfr1082	C	A	2: 86,594,400	V143F	possibly damaging	Het
Olfr127	T	C	17: 37,904,224	L226P	probably damaging	Het
Olfr137	T	A	17: 38,304,981	H160L	probably damaging	Het
Pawr	T	A	10: 108,382,742	Y170N	probably damaging	Het
Pde12	T	C	14: 26,669,125	D143G	possibly damaging	Het
Phactr2	A	G	10: 13,253,732	I264T	probably benign	Het
Pip5k1b	A	G	19: 24,397,058	L53P	probably damaging	Het
Pknox1	T	C	17: 31,599,546	I251T	probably benign	Het
Plcxd1	A	T	5: 110,101,975		probably benign	Het
Polr3c	C	T	3: 96,715,201		probably benign	Het
Ppil2	T	C	16: 17,097,405	N113S	probably benign	Het
Pramel4	G	C	4: 144,068,482	G483R	probably damaging	Het
Prdm10	T	C	9: 31,327,397	L195P	probably damaging	Het
Prss16	A	T	13: 22,003,005	L465Q	possibly damaging	Het
Psg25	G	T	7: 18,529,594	H101Q	possibly damaging	Het
Pstpip2	A	G	18: 77,846,408	D55G	possibly damaging	Het
Rfc1	A	T	5: 65,278,792	D636E	possibly damaging	Het
Scarf2	G	T	16: 17,803,110	C214F	probably damaging	Het
Sirt4	T	C	5: 115,482,645	E156G	probably damaging	Het
Spag6	C	T	2: 18,734,117	S286L	probably benign	Het
Stx17	T	A	4: 48,183,444	H267Q	unknown	Het
Tekt3	T	C	11: 63,070,232	C76R	probably benign	Het
Tln1	A	T	4: 43,538,281	V1807E	possibly damaging	Het
Tnfrsf21	A	G	17: 43,085,481	D552G	probably damaging	Het
Ttn	C	A	2: 76,730,320	V29246L	possibly damaging	Het
Usp43	C	A	11: 67,898,962	C252F	probably damaging	Het
Vmn2r16	T	C	5: 109,340,044	I261T	probably benign	Het
Vwa5b1	T	C	4: 138,581,219	E769G	probably benign	Het
Xrn1	T	A	9: 95,991,193	F670Y	probably benign	Het
Zc3h7b	G	A	15: 81,772,480	R166Q	probably benign	Het
Zdhhc14	A	T	17: 5,725,295	Y274F	possibly damaging	Het
Zeb2	T	A	2: 44,996,127	M973L	probably benign	Het
Zfp638	T	C	6: 83,977,053	V1380A	possibly damaging	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74586835	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74548357	splice site	probably benign
IGL01874:Adgrb1	APN	15	74541574	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74541575	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74529782	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74540477	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74574112	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74586805	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74588294	splice site	probably benign
IGL02678:Adgrb1	APN	15	74538328	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74547622	missense	probably damaging	0.98
Bunting	UTSW	15	74543701	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74541659	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74572156	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74586807	missense	probably benign
R0267:Adgrb1	UTSW	15	74529389	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74587149	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74543349	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74541559	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74540892	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74548549	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74547685	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74550039	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74588107	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74529343	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74541827	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74529540	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74580586	nonsense	probably null
R1895:Adgrb1	UTSW	15	74540465	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74539877	splice site	probably benign
R2114:Adgrb1	UTSW	15	74540562	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74529908	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74547704	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74545015	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74588308	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74582943	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74543662	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74577453	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74584429	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74588114	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74529479	nonsense	probably null
R4760:Adgrb1	UTSW	15	74571463	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74588129	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74587022	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74572162	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74529815	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74543701	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74577499	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74550027	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74541574	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74538370	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74540459	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74588143	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74529361	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74550024	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74529901	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74574110	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74569881	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74569948	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74569884	missense	probably benign
R7283:Adgrb1	UTSW	15	74580663	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74548569	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74543638	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74541611	missense	probably benign	0.00
R8152:Adgrb1	UTSW	15	74545000	missense	probably damaging	0.98
R8198:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74548304	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74575851	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74543508	missense	probably damaging	0.97
R9044:Adgrb1	UTSW	15	74569899	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74543340	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74548626	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74563958	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74541676	missense	probably damaging	1.00
Z1177:Adgrb1	UTSW	15	74547683	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTGTAGGAACCTCCATGCATTG -3'
(R):5'- ATGTGGTCACAGCCCAGTTC -3'

Sequencing Primer
(F):5'- CATGCATTGGAGGTCCCTG -3'
(R):5'- AGTTCACACTCAGCATTGGG -3'

Posted On

2021-07-15