Incidental Mutation 'R8865:Adgrb1'
ID 675888
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Name adhesion G protein-coupled receptor B1
Synonyms B830018M07Rik, Bai1
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8865 (G1)
Quality Score 210.009
Status Validated
Chromosome 15
Chromosomal Location 74388045-74461314 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74415507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 696 (I696V)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
AlphaFold Q3UHD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000042035
AA Change: I696V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: I696V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186360
AA Change: I696V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: I696V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Meta Mutation Damage Score 0.1356 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Cep192 T C 18: 67,967,703 (GRCm39) V729A probably benign Het
Chd6 G A 2: 160,862,989 (GRCm39) A444V probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Insr A T 8: 3,211,358 (GRCm39) D1160E probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or14j6 T C 17: 38,215,115 (GRCm39) L226P probably damaging Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Ypel1 T C 16: 16,915,269 (GRCm39) N113S probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74,458,684 (GRCm39) missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74,420,206 (GRCm39) splice site probably benign
IGL01874:Adgrb1 APN 15 74,413,423 (GRCm39) missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74,413,424 (GRCm39) missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74,401,631 (GRCm39) missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74,412,326 (GRCm39) missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74,445,961 (GRCm39) missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74,458,654 (GRCm39) missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74,460,143 (GRCm39) splice site probably benign
IGL02678:Adgrb1 APN 15 74,410,177 (GRCm39) missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74,419,471 (GRCm39) missense probably damaging 0.98
Bunting UTSW 15 74,415,550 (GRCm39) missense probably null 0.94
BB005:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
BB015:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
PIT4520001:Adgrb1 UTSW 15 74,413,508 (GRCm39) missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74,444,005 (GRCm39) missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74,458,656 (GRCm39) missense probably benign
R0267:Adgrb1 UTSW 15 74,401,238 (GRCm39) missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74,458,998 (GRCm39) missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74,415,198 (GRCm39) missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74,413,408 (GRCm39) missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74,412,741 (GRCm39) missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74,420,398 (GRCm39) missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74,452,466 (GRCm39) missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74,419,534 (GRCm39) missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74,421,888 (GRCm39) missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74,452,466 (GRCm39) missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74,459,956 (GRCm39) missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74,401,192 (GRCm39) missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74,413,676 (GRCm39) missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74,401,389 (GRCm39) missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74,452,435 (GRCm39) nonsense probably null
R1895:Adgrb1 UTSW 15 74,412,314 (GRCm39) missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74,411,726 (GRCm39) splice site probably benign
R2114:Adgrb1 UTSW 15 74,412,411 (GRCm39) critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74,401,757 (GRCm39) missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74,419,553 (GRCm39) missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74,416,864 (GRCm39) missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74,460,157 (GRCm39) missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74,454,792 (GRCm39) missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74,415,511 (GRCm39) missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74,449,302 (GRCm39) unclassified probably benign
R4634:Adgrb1 UTSW 15 74,456,278 (GRCm39) utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74,459,963 (GRCm39) missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74,401,328 (GRCm39) nonsense probably null
R4760:Adgrb1 UTSW 15 74,443,312 (GRCm39) missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74,459,978 (GRCm39) missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74,458,871 (GRCm39) missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74,444,011 (GRCm39) missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74,401,664 (GRCm39) missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74,415,550 (GRCm39) missense probably null 0.94
R5225:Adgrb1 UTSW 15 74,449,348 (GRCm39) unclassified probably benign
R5421:Adgrb1 UTSW 15 74,421,876 (GRCm39) missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74,413,423 (GRCm39) missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74,410,219 (GRCm39) missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74,412,292 (GRCm39) missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74,412,292 (GRCm39) missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74,412,308 (GRCm39) missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74,459,992 (GRCm39) critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74,401,210 (GRCm39) missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74,421,873 (GRCm39) missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74,401,750 (GRCm39) missense probably damaging 0.97
R7015:Adgrb1 UTSW 15 74,445,959 (GRCm39) missense probably damaging 1.00
R7061:Adgrb1 UTSW 15 74,441,730 (GRCm39) missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74,441,797 (GRCm39) missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74,441,733 (GRCm39) missense probably benign
R7283:Adgrb1 UTSW 15 74,452,512 (GRCm39) missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74,411,094 (GRCm39) missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74,420,418 (GRCm39) missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74,415,487 (GRCm39) missense possibly damaging 0.95
R7928:Adgrb1 UTSW 15 74,410,170 (GRCm39) missense probably damaging 1.00
R8152:Adgrb1 UTSW 15 74,416,849 (GRCm39) missense probably damaging 0.98
R8152:Adgrb1 UTSW 15 74,413,460 (GRCm39) missense probably benign 0.00
R8198:Adgrb1 UTSW 15 74,411,094 (GRCm39) missense probably damaging 0.99
R8485:Adgrb1 UTSW 15 74,420,153 (GRCm39) missense probably damaging 1.00
R8528:Adgrb1 UTSW 15 74,447,700 (GRCm39) missense possibly damaging 0.51
R8534:Adgrb1 UTSW 15 74,415,357 (GRCm39) missense probably damaging 0.97
R9044:Adgrb1 UTSW 15 74,441,748 (GRCm39) missense possibly damaging 0.95
R9098:Adgrb1 UTSW 15 74,415,189 (GRCm39) missense probably damaging 1.00
R9157:Adgrb1 UTSW 15 74,411,624 (GRCm39) missense probably damaging 0.98
R9166:Adgrb1 UTSW 15 74,420,475 (GRCm39) missense probably benign 0.00
R9313:Adgrb1 UTSW 15 74,411,624 (GRCm39) missense probably damaging 0.98
R9445:Adgrb1 UTSW 15 74,435,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Adgrb1 UTSW 15 74,419,532 (GRCm39) missense probably damaging 0.99
Z1177:Adgrb1 UTSW 15 74,413,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTAGGAACCTCCATGCATTG -3'
(R):5'- ATGTGGTCACAGCCCAGTTC -3'

Sequencing Primer
(F):5'- CATGCATTGGAGGTCCCTG -3'
(R):5'- AGTTCACACTCAGCATTGGG -3'
Posted On 2021-07-15