Incidental Mutation 'R8865:Zc3h7b'
ID 675889
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Name zinc finger CCCH type containing 7B
Synonyms Scrg3
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 81629299-81680470 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 81656681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 166 (R166Q)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554] [ENSMUST00000230946]
AlphaFold F8VPP8
Predicted Effect probably benign
Transcript: ENSMUST00000109554
AA Change: R166Q

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: R166Q

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230946
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Adgrb1 A G 15: 74,415,507 (GRCm39) I696V possibly damaging Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Cep192 T C 18: 67,967,703 (GRCm39) V729A probably benign Het
Chd6 G A 2: 160,862,989 (GRCm39) A444V probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Insr A T 8: 3,211,358 (GRCm39) D1160E probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or14j6 T C 17: 38,215,115 (GRCm39) L226P probably damaging Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Ypel1 T C 16: 16,915,269 (GRCm39) N113S probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81,656,000 (GRCm39) missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81,676,205 (GRCm39) missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81,677,338 (GRCm39) missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81,653,341 (GRCm39) missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81,676,175 (GRCm39) missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81,662,872 (GRCm39) missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81,660,529 (GRCm39) missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81,653,031 (GRCm39) splice site probably benign
R0471:Zc3h7b UTSW 15 81,666,169 (GRCm39) missense probably damaging 1.00
R0590:Zc3h7b UTSW 15 81,661,199 (GRCm39) missense possibly damaging 0.74
R1530:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1563:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1565:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1566:Zc3h7b UTSW 15 81,653,035 (GRCm39) missense possibly damaging 0.91
R1670:Zc3h7b UTSW 15 81,661,268 (GRCm39) missense probably benign
R1712:Zc3h7b UTSW 15 81,661,289 (GRCm39) missense probably benign
R1727:Zc3h7b UTSW 15 81,652,230 (GRCm39) missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81,676,529 (GRCm39) missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81,676,703 (GRCm39) missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81,664,631 (GRCm39) missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81,676,451 (GRCm39) missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81,653,384 (GRCm39) critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81,677,864 (GRCm39) missense probably damaging 1.00
R4999:Zc3h7b UTSW 15 81,663,334 (GRCm39) missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81,677,375 (GRCm39) missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81,657,515 (GRCm39) missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81,656,702 (GRCm39) missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81,670,092 (GRCm39) missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81,656,059 (GRCm39) missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81,657,499 (GRCm39) missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81,676,236 (GRCm39) missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81,662,911 (GRCm39) critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81,667,386 (GRCm39) missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81,677,055 (GRCm39) missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81,653,252 (GRCm39) missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81,655,988 (GRCm39) missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81,653,354 (GRCm39) missense possibly damaging 0.50
R7450:Zc3h7b UTSW 15 81,667,281 (GRCm39) missense probably benign
R7471:Zc3h7b UTSW 15 81,664,682 (GRCm39) missense probably damaging 1.00
R7575:Zc3h7b UTSW 15 81,662,086 (GRCm39) nonsense probably null
R7645:Zc3h7b UTSW 15 81,664,803 (GRCm39) missense probably damaging 1.00
R7650:Zc3h7b UTSW 15 81,677,851 (GRCm39) missense possibly damaging 0.81
R7881:Zc3h7b UTSW 15 81,664,679 (GRCm39) missense probably damaging 1.00
R7918:Zc3h7b UTSW 15 81,653,189 (GRCm39) missense probably damaging 0.98
R8001:Zc3h7b UTSW 15 81,663,461 (GRCm39) nonsense probably null
R8504:Zc3h7b UTSW 15 81,664,719 (GRCm39) missense probably damaging 1.00
R8855:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8856:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8857:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8866:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8867:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R8868:Zc3h7b UTSW 15 81,656,681 (GRCm39) missense probably benign 0.01
R9071:Zc3h7b UTSW 15 81,677,964 (GRCm39) makesense probably null
R9136:Zc3h7b UTSW 15 81,653,312 (GRCm39) missense probably damaging 1.00
R9169:Zc3h7b UTSW 15 81,661,184 (GRCm39) missense probably benign 0.19
R9701:Zc3h7b UTSW 15 81,676,505 (GRCm39) missense probably damaging 1.00
R9802:Zc3h7b UTSW 15 81,676,505 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGACTTAGAAAGCCAGCAAC -3'
(R):5'- TACAGCTGGTGTCTGCAGTG -3'

Sequencing Primer
(F):5'- AGCAACAGCTCCCAGGG -3'
(R):5'- AGGGTCCTACTGCTCATTCCAG -3'
Posted On 2021-07-15