Incidental Mutation 'R8865:Ypel1'
ID 675891
Institutional Source Beutler Lab
Gene Symbol Ypel1
Ensembl Gene ENSMUSG00000022773
Gene Name yippee like 1
Synonyms 1700016N17Rik, Dgl1, Ppil2, 1700019O22Rik, mdgl-1, 0610009L05Rik, 4921520K19Rik, 4930511F14Rik
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 16887560-16904909 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16915269 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 113 (N113S)
Ref Sequence ENSEMBL: ENSMUSP00000023455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]
AlphaFold Q9ESC7
Predicted Effect probably benign
Transcript: ENSMUST00000023455
AA Change: N113S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: N113S

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164458
AA Change: N113S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: N113S

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231245
AA Change: N113S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000231451
AA Change: N113S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000231712
AA Change: N113S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in the region associated with DiGeorge syndrome on chromosome 22. The encoded protein localizes to the centrosome and nucleolus and may play a role in the regulation of cell division. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Adgrb1 A G 15: 74,415,507 (GRCm39) I696V possibly damaging Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Cep192 T C 18: 67,967,703 (GRCm39) V729A probably benign Het
Chd6 G A 2: 160,862,989 (GRCm39) A444V probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Insr A T 8: 3,211,358 (GRCm39) D1160E probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or14j6 T C 17: 38,215,115 (GRCm39) L226P probably damaging Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Ypel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ypel1 APN 16 16,909,076 (GRCm39) missense probably damaging 1.00
IGL02392:Ypel1 APN 16 16,906,702 (GRCm39) missense probably benign
IGL02559:Ypel1 APN 16 16,927,515 (GRCm39) missense possibly damaging 0.80
IGL02708:Ypel1 APN 16 16,923,872 (GRCm39) missense probably benign 0.03
IGL02724:Ypel1 APN 16 16,921,466 (GRCm39) missense probably benign 0.08
zagnut UTSW 16 16,913,905 (GRCm39) missense possibly damaging 0.62
R0592:Ypel1 UTSW 16 16,925,083 (GRCm39) missense probably benign
R0975:Ypel1 UTSW 16 16,925,077 (GRCm39) missense probably benign 0.00
R1258:Ypel1 UTSW 16 16,923,917 (GRCm39) missense probably damaging 1.00
R1594:Ypel1 UTSW 16 16,899,985 (GRCm39) missense probably damaging 1.00
R1677:Ypel1 UTSW 16 16,921,474 (GRCm39) missense probably damaging 1.00
R1728:Ypel1 UTSW 16 16,907,283 (GRCm39) unclassified probably benign
R1739:Ypel1 UTSW 16 16,907,283 (GRCm39) unclassified probably benign
R1784:Ypel1 UTSW 16 16,907,283 (GRCm39) unclassified probably benign
R1853:Ypel1 UTSW 16 16,925,087 (GRCm39) missense probably benign 0.00
R1856:Ypel1 UTSW 16 16,899,511 (GRCm39) splice site probably null
R1921:Ypel1 UTSW 16 16,900,443 (GRCm39) missense probably benign 0.00
R3608:Ypel1 UTSW 16 16,910,154 (GRCm39) nonsense probably null
R3769:Ypel1 UTSW 16 16,927,532 (GRCm39) missense probably benign 0.30
R4445:Ypel1 UTSW 16 16,921,464 (GRCm39) nonsense probably null
R4518:Ypel1 UTSW 16 16,913,905 (GRCm39) missense possibly damaging 0.62
R5066:Ypel1 UTSW 16 16,927,539 (GRCm39) missense probably benign 0.03
R5085:Ypel1 UTSW 16 16,902,472 (GRCm39) splice site probably null
R5842:Ypel1 UTSW 16 16,912,851 (GRCm39) missense possibly damaging 0.66
R6013:Ypel1 UTSW 16 16,918,129 (GRCm39) missense probably damaging 1.00
R6030:Ypel1 UTSW 16 16,902,377 (GRCm39) splice site probably null
R6030:Ypel1 UTSW 16 16,902,377 (GRCm39) splice site probably null
R6415:Ypel1 UTSW 16 16,921,438 (GRCm39) critical splice donor site probably null
R6978:Ypel1 UTSW 16 16,902,438 (GRCm39) missense probably benign 0.01
R7735:Ypel1 UTSW 16 16,918,124 (GRCm39) missense probably benign 0.11
R9173:Ypel1 UTSW 16 16,915,298 (GRCm39) nonsense probably null
R9720:Ypel1 UTSW 16 16,910,890 (GRCm39) missense probably damaging 0.99
RF014:Ypel1 UTSW 16 16,915,282 (GRCm39) missense probably damaging 1.00
X0010:Ypel1 UTSW 16 16,912,901 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGTGCTAGAGGCTACGAAAG -3'
(R):5'- CTAGGCAAATACCCTGCTGC -3'

Sequencing Primer
(F):5'- GGTATGAGGACAGGCATGCTC -3'
(R):5'- CCACTTTGAGACAATGTCGTG -3'
Posted On 2021-07-15