Incidental Mutation 'R8865:Scarf2'
ID 675892
Institutional Source Beutler Lab
Gene Symbol Scarf2
Ensembl Gene ENSMUSG00000012017
Gene Name scavenger receptor class F, member 2
Synonyms Srec2, SREC-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17797282-17808293 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 17803110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 214 (C214F)
Ref Sequence ENSEMBL: ENSMUSP00000012161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012161] [ENSMUST00000232577]
AlphaFold P59222
Predicted Effect probably damaging
Transcript: ENSMUST00000012161
AA Change: C214F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000012161
Gene: ENSMUSG00000012017
AA Change: C214F

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 71 102 4.56e0 SMART
EGF 113 145 2.43e1 SMART
EGF 147 174 2.03e1 SMART
EGF_like 207 233 1.68e0 SMART
EGF 235 262 1.73e1 SMART
EGF_like 309 352 2.86e1 SMART
EGF_like 323 364 4.97e0 SMART
EGF_like 367 407 8.13e-1 SMART
low complexity region 437 459 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 597 606 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
low complexity region 636 656 N/A INTRINSIC
low complexity region 665 685 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231301
Predicted Effect probably damaging
Transcript: ENSMUST00000232577
AA Change: C214F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3816 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to SCARF1/SREC-I, a scavenger receptor protein that mediates the binding and degradation of acetylated low density lipoprotein (Ac-LDL). This protein has only little activity of internalizing modified low density lipoproteins (LDL), but it can interact with SCARF1 through its extracellular domain. The association of this protein with SCARF1 is suppressed by the presence of scavenger ligands. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr127 T C 17: 37,904,224 L226P probably damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Scarf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Scarf2 APN 16 17802549 missense probably damaging 1.00
IGL02166:Scarf2 APN 16 17803756 missense probably damaging 0.99
IGL02604:Scarf2 APN 16 17803744 missense probably damaging 0.97
IGL03155:Scarf2 APN 16 17807549 missense probably benign 0.00
R0639:Scarf2 UTSW 16 17806505 splice site probably null
R1703:Scarf2 UTSW 16 17802849 missense probably damaging 0.99
R2182:Scarf2 UTSW 16 17803022 missense probably damaging 1.00
R4730:Scarf2 UTSW 16 17803013 missense probably damaging 0.99
R4744:Scarf2 UTSW 16 17803516 missense probably damaging 0.99
R4798:Scarf2 UTSW 16 17803507 missense probably damaging 1.00
R5521:Scarf2 UTSW 16 17803602 critical splice donor site probably null
R5994:Scarf2 UTSW 16 17806379 missense probably damaging 0.99
R6742:Scarf2 UTSW 16 17806487 missense probably damaging 1.00
R7264:Scarf2 UTSW 16 17803290 missense possibly damaging 0.63
R7286:Scarf2 UTSW 16 17802973 nonsense probably null
R7385:Scarf2 UTSW 16 17803838 missense probably damaging 1.00
R7409:Scarf2 UTSW 16 17807054 missense probably damaging 0.99
R7812:Scarf2 UTSW 16 17803828 missense probably damaging 1.00
R8442:Scarf2 UTSW 16 17806367 missense probably benign 0.43
R8803:Scarf2 UTSW 16 17802831 missense probably damaging 0.98
R8987:Scarf2 UTSW 16 17804904 missense probably damaging 0.99
R9047:Scarf2 UTSW 16 17806406 missense probably damaging 0.96
R9594:Scarf2 UTSW 16 17802609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGGTTCTTGCAGAGTGC -3'
(R):5'- ATAGAATCCAGCGGGGCATG -3'

Sequencing Primer
(F):5'- ATGCTTGCCAATGCCAGCATG -3'
(R):5'- ATGGCTCGCGACAATACTTG -3'
Posted On 2021-07-15