Incidental Mutation 'R8865:Olfr127'
ID 675897
Institutional Source Beutler Lab
Gene Symbol Olfr127
Ensembl Gene ENSMUSG00000058114
Gene Name olfactory receptor 127
Synonyms MOR218-7, GA_x6K02T2PSCP-2354126-2355093
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37900437-37906795 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37904224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 226 (L226P)
Ref Sequence ENSEMBL: ENSMUSP00000149133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076331] [ENSMUST00000217223]
AlphaFold Q8VF25
Predicted Effect probably damaging
Transcript: ENSMUST00000076331
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075669
Gene: ENSMUSG00000058114
AA Change: L226P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217223
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,781,744 Y606* probably null Het
Adgrb1 A G 15: 74,543,658 I696V possibly damaging Het
Ass1 A G 2: 31,520,395 Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc148 T C 2: 58,829,820 K409R possibly damaging Het
Ccnl1 A T 3: 65,946,848 S451T probably benign Het
Cdc123 T C 2: 5,795,424 probably benign Het
Cep192 T C 18: 67,834,632 V729A probably benign Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Chl1 A G 6: 103,708,861 K898E probably damaging Het
Chrng T C 1: 87,207,497 V154A probably damaging Het
Cog1 T G 11: 113,658,498 M799R probably benign Het
Col4a3 G A 1: 82,669,762 probably null Het
Coro6 C A 11: 77,469,091 T366K probably damaging Het
Cwh43 G A 5: 73,441,359 M640I probably benign Het
Cyp2c55 A G 19: 39,031,434 E272G probably benign Het
Cyp4f39 A G 17: 32,483,297 Y256C probably damaging Het
Dbx2 G A 15: 95,632,400 R229* probably null Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
En1 G T 1: 120,603,000 probably benign Het
F3 T A 3: 121,729,411 V90E probably damaging Het
Fam171a1 A G 2: 3,225,903 K691R probably damaging Het
Foxp2 C T 6: 15,415,094 A609V unknown Het
Hemgn A T 4: 46,396,682 S185T possibly damaging Het
Hk1 C T 10: 62,315,515 D33N probably benign Het
Igfbp1 T A 11: 7,201,929 V244D probably damaging Het
Insr A T 8: 3,161,358 D1160E probably damaging Het
Irs1 A T 1: 82,288,109 Y795* probably null Het
Krtap28-10 T C 1: 83,042,087 K111E unknown Het
Lbx1 T G 19: 45,235,166 D21A probably benign Het
Map6 G T 7: 99,268,985 A322S probably benign Het
Mat1a T C 14: 41,121,831 Y336H probably damaging Het
Mcf2l A G 8: 12,880,003 I8V probably benign Het
Med12l T C 3: 59,071,882 V276A probably benign Het
Mettl17 A G 14: 51,884,851 probably benign Het
Mllt1 T C 17: 56,900,295 D183G possibly damaging Het
Msmb T A 14: 32,150,260 C69* probably null Het
Mterf1a A G 5: 3,891,425 S148P probably damaging Het
Mybl2 A G 2: 163,080,733 I583V probably benign Het
Nbr1 T A 11: 101,564,694 D91E probably benign Het
Notch3 A G 17: 32,122,116 Y2221H probably benign Het
Npat C A 9: 53,570,640 T1216N probably benign Het
Olfr1082 C A 2: 86,594,400 V143F possibly damaging Het
Olfr137 T A 17: 38,304,981 H160L probably damaging Het
Pawr T A 10: 108,382,742 Y170N probably damaging Het
Pde12 T C 14: 26,669,125 D143G possibly damaging Het
Phactr2 A G 10: 13,253,732 I264T probably benign Het
Pip5k1b A G 19: 24,397,058 L53P probably damaging Het
Pknox1 T C 17: 31,599,546 I251T probably benign Het
Plcxd1 A T 5: 110,101,975 probably benign Het
Polr3c C T 3: 96,715,201 probably benign Het
Ppil2 T C 16: 17,097,405 N113S probably benign Het
Pramel4 G C 4: 144,068,482 G483R probably damaging Het
Prdm10 T C 9: 31,327,397 L195P probably damaging Het
Prss16 A T 13: 22,003,005 L465Q possibly damaging Het
Psg25 G T 7: 18,529,594 H101Q possibly damaging Het
Pstpip2 A G 18: 77,846,408 D55G possibly damaging Het
Rfc1 A T 5: 65,278,792 D636E possibly damaging Het
Scarf2 G T 16: 17,803,110 C214F probably damaging Het
Sirt4 T C 5: 115,482,645 E156G probably damaging Het
Spag6 C T 2: 18,734,117 S286L probably benign Het
Stx17 T A 4: 48,183,444 H267Q unknown Het
Tekt3 T C 11: 63,070,232 C76R probably benign Het
Tln1 A T 4: 43,538,281 V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,085,481 D552G probably damaging Het
Ttn C A 2: 76,730,320 V29246L possibly damaging Het
Usp43 C A 11: 67,898,962 C252F probably damaging Het
Vmn2r16 T C 5: 109,340,044 I261T probably benign Het
Vwa5b1 T C 4: 138,581,219 E769G probably benign Het
Xrn1 T A 9: 95,991,193 F670Y probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zdhhc14 A T 17: 5,725,295 Y274F possibly damaging Het
Zeb2 T A 2: 44,996,127 M973L probably benign Het
Zfp638 T C 6: 83,977,053 V1380A possibly damaging Het
Other mutations in Olfr127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr127 APN 17 37904257 missense probably damaging 0.98
IGL00981:Olfr127 APN 17 37904181 missense probably benign 0.03
IGL02271:Olfr127 APN 17 37904243 missense probably benign 0.22
IGL02409:Olfr127 APN 17 37903788 missense probably damaging 0.99
R1649:Olfr127 UTSW 17 37904169 missense probably benign 0.09
R1808:Olfr127 UTSW 17 37903770 missense probably damaging 1.00
R2360:Olfr127 UTSW 17 37904454 missense possibly damaging 0.94
R3808:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3809:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3953:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3955:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3957:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R4683:Olfr127 UTSW 17 37904148 missense probably benign
R5430:Olfr127 UTSW 17 37904413 missense probably damaging 1.00
R5716:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R5866:Olfr127 UTSW 17 37903809 nonsense probably null
R7074:Olfr127 UTSW 17 37903827 missense possibly damaging 0.80
R7238:Olfr127 UTSW 17 37904437 missense probably benign 0.37
R8098:Olfr127 UTSW 17 37904359 missense probably damaging 1.00
R8212:Olfr127 UTSW 17 37904257 missense probably benign 0.00
R8559:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R9046:Olfr127 UTSW 17 37904254 missense probably damaging 1.00
R9049:Olfr127 UTSW 17 37903873 nonsense probably null
R9371:Olfr127 UTSW 17 37904071 missense probably benign 0.10
X0021:Olfr127 UTSW 17 37903756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCACAAAATTATTCACCAG -3'
(R):5'- TGTCCAGTCTTAGCAGGCAC -3'

Sequencing Primer
(F):5'- GGCACAAAATTATTCACCAGTTCTTC -3'
(R):5'- GTCTTAGCAGGCACTAAAAACAG -3'
Posted On 2021-07-15