Incidental Mutation 'R8865:Or14j6'
ID 675897
Institutional Source Beutler Lab
Gene Symbol Or14j6
Ensembl Gene ENSMUSG00000058114
Gene Name olfactory receptor family 14 subfamily J member 6
Synonyms MOR218-7, Olfr127, GA_x6K02T2PSCP-2354126-2355093
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 38214439-38215410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38215115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 226 (L226P)
Ref Sequence ENSEMBL: ENSMUSP00000149133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076331] [ENSMUST00000217223]
AlphaFold Q8VF25
Predicted Effect probably damaging
Transcript: ENSMUST00000076331
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075669
Gene: ENSMUSG00000058114
AA Change: L226P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217223
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Adgrb1 A G 15: 74,415,507 (GRCm39) I696V possibly damaging Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Cep192 T C 18: 67,967,703 (GRCm39) V729A probably benign Het
Chd6 G A 2: 160,862,989 (GRCm39) A444V probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Insr A T 8: 3,211,358 (GRCm39) D1160E probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Ypel1 T C 16: 16,915,269 (GRCm39) N113S probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Or14j6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Or14j6 APN 17 38,215,148 (GRCm39) missense probably damaging 0.98
IGL00981:Or14j6 APN 17 38,215,072 (GRCm39) missense probably benign 0.03
IGL02271:Or14j6 APN 17 38,215,134 (GRCm39) missense probably benign 0.22
IGL02409:Or14j6 APN 17 38,214,679 (GRCm39) missense probably damaging 0.99
R1649:Or14j6 UTSW 17 38,215,060 (GRCm39) missense probably benign 0.09
R1808:Or14j6 UTSW 17 38,214,661 (GRCm39) missense probably damaging 1.00
R2360:Or14j6 UTSW 17 38,215,345 (GRCm39) missense possibly damaging 0.94
R3808:Or14j6 UTSW 17 38,214,464 (GRCm39) missense probably benign 0.00
R3809:Or14j6 UTSW 17 38,214,464 (GRCm39) missense probably benign 0.00
R3953:Or14j6 UTSW 17 38,214,500 (GRCm39) missense probably benign 0.00
R3955:Or14j6 UTSW 17 38,214,500 (GRCm39) missense probably benign 0.00
R3957:Or14j6 UTSW 17 38,214,500 (GRCm39) missense probably benign 0.00
R4683:Or14j6 UTSW 17 38,215,039 (GRCm39) missense probably benign
R5430:Or14j6 UTSW 17 38,215,304 (GRCm39) missense probably damaging 1.00
R5716:Or14j6 UTSW 17 38,214,719 (GRCm39) missense probably benign 0.00
R5866:Or14j6 UTSW 17 38,214,700 (GRCm39) nonsense probably null
R7074:Or14j6 UTSW 17 38,214,718 (GRCm39) missense possibly damaging 0.80
R7238:Or14j6 UTSW 17 38,215,328 (GRCm39) missense probably benign 0.37
R8098:Or14j6 UTSW 17 38,215,250 (GRCm39) missense probably damaging 1.00
R8212:Or14j6 UTSW 17 38,215,148 (GRCm39) missense probably benign 0.00
R8559:Or14j6 UTSW 17 38,214,719 (GRCm39) missense probably benign 0.00
R9046:Or14j6 UTSW 17 38,215,145 (GRCm39) missense probably damaging 1.00
R9049:Or14j6 UTSW 17 38,214,764 (GRCm39) nonsense probably null
R9371:Or14j6 UTSW 17 38,214,962 (GRCm39) missense probably benign 0.10
X0021:Or14j6 UTSW 17 38,214,647 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCACAAAATTATTCACCAG -3'
(R):5'- TGTCCAGTCTTAGCAGGCAC -3'

Sequencing Primer
(F):5'- GGCACAAAATTATTCACCAGTTCTTC -3'
(R):5'- GTCTTAGCAGGCACTAAAAACAG -3'
Posted On 2021-07-15