Incidental Mutation 'R0731:Rbfox2'
ID 67590
Institutional Source Beutler Lab
Gene Symbol Rbfox2
Ensembl Gene ENSMUSG00000033565
Gene Name RNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms Rbm9, 2810460A15Rik, Fxh, Fbm2
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.580) question?
Stock # R0731 (G1)
Quality Score 215
Status Validated
Chromosome 15
Chromosomal Location 76963190-77191204 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76983479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 141 (S141P)
Ref Sequence ENSEMBL: ENSMUSP00000154810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000111581] [ENSMUST00000166610] [ENSMUST00000171751] [ENSMUST00000227314] [ENSMUST00000228087] [ENSMUST00000227930] [ENSMUST00000228558] [ENSMUST00000227533]
AlphaFold Q8BP71
Predicted Effect probably benign
Transcript: ENSMUST00000048145
AA Change: S307P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565
AA Change: S307P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 319 374 2.9e-18 PFAM
low complexity region 375 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111581
AA Change: S239P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129372
Gene: ENSMUSG00000033565
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 252 350 3.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166610
AA Change: S239P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130673
Gene: ENSMUSG00000033565
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 255 353 6.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171751
AA Change: S307P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565
AA Change: S307P

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 324 421 7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181870
Predicted Effect probably benign
Transcript: ENSMUST00000227314
AA Change: S239P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228087
AA Change: S239P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000228361
AA Change: S252P
Predicted Effect probably benign
Transcript: ENSMUST00000227930
AA Change: S141P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000228558
AA Change: S261P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227533
AA Change: S207P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Rbfox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rbfox2 APN 15 76,987,136 (GRCm39) missense probably damaging 1.00
R0026:Rbfox2 UTSW 15 76,968,357 (GRCm39) missense possibly damaging 0.66
R0130:Rbfox2 UTSW 15 76,976,057 (GRCm39) intron probably benign
R0446:Rbfox2 UTSW 15 76,983,455 (GRCm39) missense probably damaging 0.98
R3013:Rbfox2 UTSW 15 77,017,120 (GRCm39) missense probably damaging 1.00
R3715:Rbfox2 UTSW 15 76,983,451 (GRCm39) missense probably damaging 0.97
R4094:Rbfox2 UTSW 15 77,016,925 (GRCm39) missense probably damaging 0.99
R4543:Rbfox2 UTSW 15 77,190,568 (GRCm39) missense probably benign 0.01
R4799:Rbfox2 UTSW 15 76,976,018 (GRCm39) missense probably benign 0.28
R6194:Rbfox2 UTSW 15 76,968,357 (GRCm39) missense possibly damaging 0.66
R7316:Rbfox2 UTSW 15 77,016,929 (GRCm39) missense possibly damaging 0.92
R7501:Rbfox2 UTSW 15 76,989,834 (GRCm39) missense probably benign 0.36
R7687:Rbfox2 UTSW 15 77,190,694 (GRCm39) missense unknown
R8030:Rbfox2 UTSW 15 76,969,776 (GRCm39) critical splice donor site probably null
R8103:Rbfox2 UTSW 15 76,983,654 (GRCm39) missense probably damaging 1.00
R9093:Rbfox2 UTSW 15 77,190,658 (GRCm39) missense probably benign
RF027:Rbfox2 UTSW 15 77,016,973 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCAGGCGAGACATGCTCTTATC -3'
(R):5'- TCAGGCTGGAAGTTAAGCCCAGTAG -3'

Sequencing Primer
(F):5'- GATCACATCCAGGTAGGATAGTTAC -3'
(R):5'- TTAAGCCCAGTAGTTGGAGC -3'
Posted On 2013-09-03