Incidental Mutation 'R8865:Cep192'
ID 675901
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Name centrosomal protein 192
Synonyms D430014P18Rik, 4631422C13Rik
MMRRC Submission 068681-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8865 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 67933177-68018241 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67967703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 729 (V729A)
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
AlphaFold E9Q4Y4
Predicted Effect probably benign
Transcript: ENSMUST00000025425
AA Change: V729A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542
AA Change: V729A

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T A 11: 50,672,571 (GRCm39) Y606* probably null Het
Adgrb1 A G 15: 74,415,507 (GRCm39) I696V possibly damaging Het
Ass1 A G 2: 31,410,407 (GRCm39) Q406R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Ccdc148 T C 2: 58,719,832 (GRCm39) K409R possibly damaging Het
Ccnl1 A T 3: 65,854,269 (GRCm39) S451T probably benign Het
Cdc123 T C 2: 5,800,235 (GRCm39) probably benign Het
Chd6 G A 2: 160,862,989 (GRCm39) A444V probably benign Het
Chl1 A G 6: 103,685,822 (GRCm39) K898E probably damaging Het
Chrng T C 1: 87,135,219 (GRCm39) V154A probably damaging Het
Cog1 T G 11: 113,549,324 (GRCm39) M799R probably benign Het
Col4a3 G A 1: 82,647,483 (GRCm39) probably null Het
Coro6 C A 11: 77,359,917 (GRCm39) T366K probably damaging Het
Cwh43 G A 5: 73,598,702 (GRCm39) M640I probably benign Het
Cyp2c55 A G 19: 39,019,878 (GRCm39) E272G probably benign Het
Cyp4f39 A G 17: 32,702,271 (GRCm39) Y256C probably damaging Het
Dbx2 G A 15: 95,530,281 (GRCm39) R229* probably null Het
Dcdc2a C T 13: 25,386,266 (GRCm39) A380V probably benign Het
En1 G T 1: 120,530,729 (GRCm39) probably benign Het
F3 T A 3: 121,523,060 (GRCm39) V90E probably damaging Het
Fam171a1 A G 2: 3,226,940 (GRCm39) K691R probably damaging Het
Foxp2 C T 6: 15,415,093 (GRCm39) A609V unknown Het
Hemgn A T 4: 46,396,682 (GRCm39) S185T possibly damaging Het
Hk1 C T 10: 62,151,294 (GRCm39) D33N probably benign Het
Igfbp1 T A 11: 7,151,929 (GRCm39) V244D probably damaging Het
Insr A T 8: 3,211,358 (GRCm39) D1160E probably damaging Het
Irs1 A T 1: 82,265,830 (GRCm39) Y795* probably null Het
Krtap28-10 T C 1: 83,019,808 (GRCm39) K111E unknown Het
Lbx1 T G 19: 45,223,605 (GRCm39) D21A probably benign Het
Map6 G T 7: 98,918,192 (GRCm39) A322S probably benign Het
Mat1a T C 14: 40,843,788 (GRCm39) Y336H probably damaging Het
Mcf2l A G 8: 12,930,003 (GRCm39) I8V probably benign Het
Med12l T C 3: 58,979,303 (GRCm39) V276A probably benign Het
Mettl17 A G 14: 52,122,308 (GRCm39) probably benign Het
Mllt1 T C 17: 57,207,295 (GRCm39) D183G possibly damaging Het
Msmb T A 14: 31,872,217 (GRCm39) C69* probably null Het
Mterf1a A G 5: 3,941,425 (GRCm39) S148P probably damaging Het
Mybl2 A G 2: 162,922,653 (GRCm39) I583V probably benign Het
Nbr1 T A 11: 101,455,520 (GRCm39) D91E probably benign Het
Notch3 A G 17: 32,341,090 (GRCm39) Y2221H probably benign Het
Npat C A 9: 53,481,940 (GRCm39) T1216N probably benign Het
Or14j6 T C 17: 38,215,115 (GRCm39) L226P probably damaging Het
Or2j3 T A 17: 38,615,872 (GRCm39) H160L probably damaging Het
Or8k35 C A 2: 86,424,744 (GRCm39) V143F possibly damaging Het
Pawr T A 10: 108,218,603 (GRCm39) Y170N probably damaging Het
Pde12 T C 14: 26,390,280 (GRCm39) D143G possibly damaging Het
Phactr2 A G 10: 13,129,476 (GRCm39) I264T probably benign Het
Pip5k1b A G 19: 24,374,422 (GRCm39) L53P probably damaging Het
Pknox1 T C 17: 31,818,520 (GRCm39) I251T probably benign Het
Plcxd1 A T 5: 110,249,841 (GRCm39) probably benign Het
Polr3c C T 3: 96,622,517 (GRCm39) probably benign Het
Pramel4 G C 4: 143,795,052 (GRCm39) G483R probably damaging Het
Prdm10 T C 9: 31,238,693 (GRCm39) L195P probably damaging Het
Prss16 A T 13: 22,187,175 (GRCm39) L465Q possibly damaging Het
Psg25 G T 7: 18,263,519 (GRCm39) H101Q possibly damaging Het
Pstpip2 A G 18: 77,934,108 (GRCm39) D55G possibly damaging Het
Rfc1 A T 5: 65,436,135 (GRCm39) D636E possibly damaging Het
Scarf2 G T 16: 17,620,974 (GRCm39) C214F probably damaging Het
Sirt4 T C 5: 115,620,704 (GRCm39) E156G probably damaging Het
Spag6 C T 2: 18,738,928 (GRCm39) S286L probably benign Het
Stx17 T A 4: 48,183,444 (GRCm39) H267Q unknown Het
Tekt3 T C 11: 62,961,058 (GRCm39) C76R probably benign Het
Tln1 A T 4: 43,538,281 (GRCm39) V1807E possibly damaging Het
Tnfrsf21 A G 17: 43,396,372 (GRCm39) D552G probably damaging Het
Ttn C A 2: 76,560,664 (GRCm39) V29246L possibly damaging Het
Usp43 C A 11: 67,789,788 (GRCm39) C252F probably damaging Het
Vmn2r16 T C 5: 109,487,910 (GRCm39) I261T probably benign Het
Vwa5b1 T C 4: 138,308,530 (GRCm39) E769G probably benign Het
Xrn1 T A 9: 95,873,246 (GRCm39) F670Y probably benign Het
Ypel1 T C 16: 16,915,269 (GRCm39) N113S probably benign Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zdhhc14 A T 17: 5,775,570 (GRCm39) Y274F possibly damaging Het
Zeb2 T A 2: 44,886,139 (GRCm39) M973L probably benign Het
Zfp638 T C 6: 83,954,035 (GRCm39) V1380A possibly damaging Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67,953,407 (GRCm39) missense probably damaging 1.00
IGL00163:Cep192 APN 18 68,013,871 (GRCm39) missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67,991,939 (GRCm39) missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67,945,477 (GRCm39) missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67,937,445 (GRCm39) missense probably damaging 0.97
IGL01302:Cep192 APN 18 67,991,974 (GRCm39) missense probably benign 0.03
IGL01653:Cep192 APN 18 67,986,043 (GRCm39) missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67,936,207 (GRCm39) missense possibly damaging 0.83
IGL02448:Cep192 APN 18 68,002,518 (GRCm39) missense probably benign 0.25
IGL02494:Cep192 APN 18 67,937,453 (GRCm39) missense probably benign 0.00
IGL02574:Cep192 APN 18 67,974,350 (GRCm39) missense probably damaging 0.99
IGL02624:Cep192 APN 18 68,013,866 (GRCm39) missense probably benign 0.20
IGL02646:Cep192 APN 18 67,995,548 (GRCm39) missense probably damaging 1.00
IGL02652:Cep192 APN 18 67,991,921 (GRCm39) splice site probably benign
IGL02684:Cep192 APN 18 67,967,634 (GRCm39) missense probably damaging 0.99
IGL02977:Cep192 APN 18 67,985,976 (GRCm39) missense probably damaging 0.97
IGL03000:Cep192 APN 18 67,985,115 (GRCm39) missense probably damaging 1.00
IGL03133:Cep192 APN 18 67,943,176 (GRCm39) missense probably benign 0.00
IGL03139:Cep192 APN 18 67,961,547 (GRCm39) critical splice donor site probably null
IGL03213:Cep192 APN 18 67,998,708 (GRCm39) missense probably damaging 1.00
IGL03250:Cep192 APN 18 67,940,426 (GRCm39) missense probably benign 0.01
IGL03259:Cep192 APN 18 67,953,483 (GRCm39) missense probably damaging 1.00
R0117:Cep192 UTSW 18 67,983,808 (GRCm39) critical splice donor site probably null
R0180:Cep192 UTSW 18 67,968,559 (GRCm39) missense probably damaging 1.00
R0281:Cep192 UTSW 18 67,961,553 (GRCm39) splice site probably benign
R0374:Cep192 UTSW 18 67,951,954 (GRCm39) nonsense probably null
R0420:Cep192 UTSW 18 67,946,964 (GRCm39) missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67,991,089 (GRCm39) missense probably damaging 1.00
R0652:Cep192 UTSW 18 67,940,336 (GRCm39) missense probably benign 0.04
R1024:Cep192 UTSW 18 67,971,125 (GRCm39) missense probably benign 0.37
R1382:Cep192 UTSW 18 67,989,370 (GRCm39) missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67,991,992 (GRCm39) missense probably damaging 1.00
R1395:Cep192 UTSW 18 67,991,992 (GRCm39) missense probably damaging 1.00
R1641:Cep192 UTSW 18 67,980,504 (GRCm39) missense probably damaging 1.00
R1704:Cep192 UTSW 18 67,989,327 (GRCm39) missense probably damaging 1.00
R1793:Cep192 UTSW 18 67,984,838 (GRCm39) missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67,937,494 (GRCm39) missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67,936,228 (GRCm39) critical splice donor site probably null
R2164:Cep192 UTSW 18 67,953,431 (GRCm39) missense probably damaging 0.99
R2180:Cep192 UTSW 18 67,957,813 (GRCm39) missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67,946,970 (GRCm39) missense probably benign 0.07
R2442:Cep192 UTSW 18 67,957,759 (GRCm39) missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67,988,341 (GRCm39) splice site probably null
R2898:Cep192 UTSW 18 67,988,341 (GRCm39) splice site probably null
R2901:Cep192 UTSW 18 68,002,512 (GRCm39) missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67,967,963 (GRCm39) missense probably benign 0.08
R3620:Cep192 UTSW 18 67,962,928 (GRCm39) missense probably benign 0.00
R3621:Cep192 UTSW 18 67,962,928 (GRCm39) missense probably benign 0.00
R3712:Cep192 UTSW 18 67,953,400 (GRCm39) missense probably benign 0.00
R4559:Cep192 UTSW 18 68,004,584 (GRCm39) missense probably damaging 1.00
R4590:Cep192 UTSW 18 67,949,862 (GRCm39) nonsense probably null
R4591:Cep192 UTSW 18 67,968,039 (GRCm39) missense probably damaging 0.99
R4604:Cep192 UTSW 18 67,948,993 (GRCm39) missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67,945,440 (GRCm39) missense probably benign 0.03
R4725:Cep192 UTSW 18 67,949,837 (GRCm39) missense probably benign
R4738:Cep192 UTSW 18 68,017,901 (GRCm39) nonsense probably null
R4739:Cep192 UTSW 18 67,984,803 (GRCm39) missense probably benign 0.02
R4927:Cep192 UTSW 18 67,968,195 (GRCm39) missense probably benign 0.16
R4948:Cep192 UTSW 18 67,949,875 (GRCm39) missense probably benign 0.00
R5090:Cep192 UTSW 18 67,993,617 (GRCm39) missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67,999,612 (GRCm39) missense probably benign 0.08
R5154:Cep192 UTSW 18 67,983,755 (GRCm39) missense probably damaging 1.00
R5192:Cep192 UTSW 18 67,968,075 (GRCm39) missense probably benign 0.03
R5735:Cep192 UTSW 18 68,013,866 (GRCm39) missense probably benign 0.20
R5812:Cep192 UTSW 18 67,984,808 (GRCm39) missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67,948,935 (GRCm39) missense probably benign 0.01
R5981:Cep192 UTSW 18 67,993,661 (GRCm39) missense probably damaging 1.00
R6131:Cep192 UTSW 18 67,971,068 (GRCm39) missense possibly damaging 0.65
R6335:Cep192 UTSW 18 67,967,784 (GRCm39) missense probably damaging 1.00
R6849:Cep192 UTSW 18 67,945,506 (GRCm39) missense probably benign 0.00
R6861:Cep192 UTSW 18 67,974,699 (GRCm39) missense probably benign 0.43
R7192:Cep192 UTSW 18 67,983,599 (GRCm39) missense probably damaging 0.99
R7264:Cep192 UTSW 18 67,953,426 (GRCm39) missense probably damaging 1.00
R7397:Cep192 UTSW 18 67,989,268 (GRCm39) missense probably damaging 1.00
R7409:Cep192 UTSW 18 67,967,874 (GRCm39) missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67,953,434 (GRCm39) missense probably damaging 1.00
R7756:Cep192 UTSW 18 67,989,384 (GRCm39) missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67,989,384 (GRCm39) missense possibly damaging 0.92
R8247:Cep192 UTSW 18 67,974,188 (GRCm39) missense probably benign 0.02
R8695:Cep192 UTSW 18 67,951,958 (GRCm39) nonsense probably null
R8935:Cep192 UTSW 18 67,995,543 (GRCm39) missense probably damaging 1.00
R9453:Cep192 UTSW 18 67,989,354 (GRCm39) nonsense probably null
R9571:Cep192 UTSW 18 67,952,109 (GRCm39) missense probably damaging 0.98
R9581:Cep192 UTSW 18 67,980,465 (GRCm39) missense probably damaging 1.00
R9599:Cep192 UTSW 18 67,968,525 (GRCm39) missense probably benign 0.19
R9779:Cep192 UTSW 18 67,968,348 (GRCm39) missense probably damaging 1.00
RF003:Cep192 UTSW 18 67,971,027 (GRCm39) missense probably benign 0.44
X0066:Cep192 UTSW 18 67,945,520 (GRCm39) splice site probably null
Z1176:Cep192 UTSW 18 68,014,359 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTCCTTGTATGTAGAGTGAG -3'
(R):5'- TCAGATGTGCCTGCTCTTG -3'

Sequencing Primer
(F):5'- ACACTGTCTGGTGGTGAA -3'
(R):5'- CAGATGTGCCTGCTCTTGAAAGG -3'
Posted On 2021-07-15