Incidental Mutation 'R8866:Tecpr1'
ID 675924
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 144194442-144223615 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144216299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: E204G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E204G

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Arhgap45 C A 10: 80,017,916 P88Q probably damaging Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Dbr1 T A 9: 99,578,444 L109* probably null Het
Dchs1 G T 7: 105,755,390 N2648K probably benign Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dlgap1 A T 17: 70,516,440 H140L probably damaging Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Eloa A C 4: 136,010,227 probably null Het
Epha7 A G 4: 28,821,614 I260V probably benign Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Fstl4 A G 11: 53,072,406 E205G possibly damaging Het
Gm5592 A T 7: 41,288,822 R509S possibly damaging Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Hgs A G 11: 120,469,638 N54S probably benign Het
Hydin G A 8: 110,582,147 V4022M possibly damaging Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Kctd4 A G 14: 75,963,025 I145M probably benign Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc10 T A 10: 117,045,953 N177K probably damaging Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Ndel1 A G 11: 68,843,819 probably null Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr387-ps1 A G 11: 73,664,999 Y130C probably damaging Het
Olfr392 A T 11: 73,814,411 S224T probably damaging Het
Olfr644 A T 7: 104,068,912 S40T probably damaging Het
Otop2 A G 11: 115,329,528 D398G probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Polr3b T A 10: 84,695,691 D810E probably benign Het
Ppl T A 16: 5,102,347 T395S probably benign Het
Ptprm G A 17: 66,809,635 A883V probably benign Het
Rapgef6 G A 11: 54,552,874 probably null Het
Rbm12 A T 2: 156,096,773 Y526* probably null Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Setd4 A G 16: 93,590,073 F246L probably damaging Het
Shank2 A G 7: 144,411,249 S865G probably benign Het
Skint6 T C 4: 112,854,453 N956D probably benign Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Tank T A 2: 61,578,661 S7R probably benign Het
Tmem5 A G 10: 122,089,048 Y250H probably damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Tor4a T C 2: 25,194,953 M313V probably benign Het
Tpd52l2 A G 2: 181,513,068 D192G probably damaging Het
Trim29 T C 9: 43,311,648 V258A probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Ttn T C 2: 76,762,331 E20819G probably damaging Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Unc80 G A 1: 66,590,229 G1295E probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Vwa5b1 T G 4: 138,600,317 E316A probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Zfp931 A T 2: 178,068,385 C69* probably null Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144214027 intron probably benign
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144217231 missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144218578 missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTTCACCATACAAAATCTTGGGC -3'
(R):5'- CTTGCTGAGTGTGGAAGGAC -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATGGTGGTG -3'
(R):5'- CTGAGTGTGGAAGGACTGGAG -3'
Posted On 2021-07-15