Incidental Mutation 'R8866:Tecpr1'
ID 675924
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 068742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144153117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: E204G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E204G

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 59,914,511 (GRCm39) T38I probably benign Het
Arhgap1 G T 2: 91,499,744 (GRCm39) S293I probably benign Het
Arhgap45 C A 10: 79,853,750 (GRCm39) P88Q probably damaging Het
Atg9a A C 1: 75,161,867 (GRCm39) F560V probably damaging Het
Btaf1 T A 19: 36,935,901 (GRCm39) N230K probably benign Het
Ccne1 A C 7: 37,800,046 (GRCm39) H179Q probably benign Het
Dbr1 T A 9: 99,460,497 (GRCm39) L109* probably null Het
Dchs1 G T 7: 105,404,597 (GRCm39) N2648K probably benign Het
Ddx47 A G 6: 135,000,356 (GRCm39) K451E probably benign Het
Dlgap1 A T 17: 70,823,435 (GRCm39) H140L probably damaging Het
Dnah11 T A 12: 118,156,107 (GRCm39) H181L probably benign Het
Dync1h1 T C 12: 110,602,333 (GRCm39) C2074R probably damaging Het
Ell2 A T 13: 75,917,793 (GRCm39) Q574H probably damaging Het
Eloa A C 4: 135,737,538 (GRCm39) probably null Het
Epha7 A G 4: 28,821,614 (GRCm39) I260V probably benign Het
Fbp2 T C 13: 62,989,709 (GRCm39) K199R probably benign Het
Fetub A T 16: 22,758,321 (GRCm39) E368V possibly damaging Het
Fsip2 A G 2: 82,810,521 (GRCm39) Q2280R probably benign Het
Fstl4 A G 11: 52,963,233 (GRCm39) E205G possibly damaging Het
Gm5592 A T 7: 40,938,246 (GRCm39) R509S possibly damaging Het
Gpld1 A G 13: 25,170,890 (GRCm39) T794A probably benign Het
Gsk3b A G 16: 38,004,900 (GRCm39) Y157C probably damaging Het
Hgs A G 11: 120,360,464 (GRCm39) N54S probably benign Het
Hydin G A 8: 111,308,779 (GRCm39) V4022M possibly damaging Het
Kank1 T C 19: 25,388,702 (GRCm39) S792P possibly damaging Het
Kctd4 A G 14: 76,200,465 (GRCm39) I145M probably benign Het
Klra5 A T 6: 129,880,533 (GRCm39) W212R probably damaging Het
Lrp6 A T 6: 134,445,785 (GRCm39) N1009K probably benign Het
Lrrc10 T A 10: 116,881,858 (GRCm39) N177K probably damaging Het
Lrrc39 T A 3: 116,363,790 (GRCm39) I121N probably damaging Het
Mov10l1 A T 15: 88,896,169 (GRCm39) D671V probably benign Het
Ndel1 A G 11: 68,734,645 (GRCm39) probably null Het
Or10g3 A T 14: 52,610,196 (GRCm39) Y105N probably damaging Het
Or1e27-ps1 A G 11: 73,555,825 (GRCm39) Y130C probably damaging Het
Or1e32 A T 11: 73,705,237 (GRCm39) S224T probably damaging Het
Or51a43 A T 7: 103,718,119 (GRCm39) S40T probably damaging Het
Otop2 A G 11: 115,220,354 (GRCm39) D398G probably benign Het
Pkd1 T C 17: 24,792,051 (GRCm39) V1246A probably damaging Het
Polr3b T A 10: 84,531,555 (GRCm39) D810E probably benign Het
Ppl T A 16: 4,920,211 (GRCm39) T395S probably benign Het
Ptprm G A 17: 67,116,630 (GRCm39) A883V probably benign Het
Rapgef6 G A 11: 54,443,700 (GRCm39) probably null Het
Rbm12 A T 2: 155,938,693 (GRCm39) Y526* probably null Het
Rbm15b C T 9: 106,763,595 (GRCm39) R191Q probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,229,120 (GRCm39) probably benign Het
Rxylt1 A G 10: 121,924,953 (GRCm39) Y250H probably damaging Het
Serpinb6c A T 13: 34,083,309 (GRCm39) I35N probably damaging Het
Setd4 A G 16: 93,386,961 (GRCm39) F246L probably damaging Het
Shank2 A G 7: 143,964,986 (GRCm39) S865G probably benign Het
Skint6 T C 4: 112,711,650 (GRCm39) N956D probably benign Het
Slc30a3 C A 5: 31,245,325 (GRCm39) V332F possibly damaging Het
Smg1 A G 7: 117,806,122 (GRCm39) S240P unknown Het
Tank T A 2: 61,409,005 (GRCm39) S7R probably benign Het
Tmem74 A G 15: 43,730,231 (GRCm39) S271P probably damaging Het
Tor4a T C 2: 25,084,965 (GRCm39) M313V probably benign Het
Tpd52l2 A G 2: 181,154,861 (GRCm39) D192G probably damaging Het
Trim29 T C 9: 43,222,945 (GRCm39) V258A probably damaging Het
Ttc39c A T 18: 12,831,003 (GRCm39) S288C probably benign Het
Ttn T C 2: 76,592,675 (GRCm39) E20819G probably damaging Het
Twnk C T 19: 45,000,272 (GRCm39) Q663* probably null Het
Ucn T A 5: 31,295,857 (GRCm39) Q3L probably benign Het
Unc80 G A 1: 66,629,388 (GRCm39) G1295E probably benign Het
Usp9y C T Y: 1,395,758 (GRCm39) R492H probably damaging Het
Vars1 T C 17: 35,234,620 (GRCm39) S1150P probably benign Het
Vwa5b1 T G 4: 138,327,628 (GRCm39) E316A probably damaging Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zfp839 A G 12: 110,834,848 (GRCm39) E701G probably benign Het
Zfp931 A T 2: 177,710,178 (GRCm39) C69* probably null Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8903:Tecpr1 UTSW 5 144,150,845 (GRCm39) intron probably benign
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTTCACCATACAAAATCTTGGGC -3'
(R):5'- CTTGCTGAGTGTGGAAGGAC -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATGGTGGTG -3'
(R):5'- CTGAGTGTGGAAGGACTGGAG -3'
Posted On 2021-07-15