Incidental Mutation 'R0731:Wfikkn1'
ID67594
Institutional Source Beutler Lab
Gene Symbol Wfikkn1
Ensembl Gene ENSMUSG00000071192
Gene NameWAP, FS, Ig, KU, and NTR-containing protein 1
Synonyms
MMRRC Submission 038912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0731 (G1)
Quality Score142
Status Validated
Chromosome17
Chromosomal Location25877630-25880305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25878017 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 444 (R444S)
Ref Sequence ENSEMBL: ENSMUSP00000093141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000026827] [ENSMUST00000095487] [ENSMUST00000110456] [ENSMUST00000163356] [ENSMUST00000166146] [ENSMUST00000167626] [ENSMUST00000169085] [ENSMUST00000169308] [ENSMUST00000176696] [ENSMUST00000179998]
Predicted Effect probably benign
Transcript: ENSMUST00000026826
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026827
SMART Domains Protein: ENSMUSP00000026827
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 203 7.4e-95 PFAM
Pfam:Methyltransf_25 31 133 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095487
AA Change: R444S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093141
Gene: ENSMUSG00000071192
AA Change: R444S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 32 82 4.04e-3 SMART
KAZAL 119 161 1.96e-2 SMART
IGc2 202 274 2.54e-14 SMART
KU 301 356 4.2e-3 SMART
KU 361 414 1.82e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110456
SMART Domains Protein: ENSMUSP00000106086
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 78 8.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably benign
Transcript: ENSMUST00000167626
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169085
SMART Domains Protein: ENSMUSP00000125990
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 65 6.5e-29 PFAM
Pfam:DUF938 64 106 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169308
SMART Domains Protein: ENSMUSP00000126198
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 194 5.6e-86 PFAM
Pfam:Methyltransf_25 31 133 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176696
SMART Domains Protein: ENSMUSP00000135083
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
WAP 2 48 8.8e-2 SMART
KAZAL 85 127 1.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179998
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted multidomain protein consisting of a signal peptide, a WAP domain, a follistatin domain, an immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. These domains have been implicated frequently in inhibition of various types of proteases, suggesting that the encoded protein may be a multivalent protease inhibitor and may control the action of multiple types of serine proteases as well as metalloproteinases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show partial penetrance of posteriorly directed homeotic transformations throughout the axial skeleton, impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T C 10: 100,586,203 T66A probably damaging Het
4933406M09Rik A C 1: 134,389,975 M162L probably benign Het
Acsm3 A T 7: 119,768,024 R27* probably null Het
Actg1 A G 11: 120,346,949 F255S probably damaging Het
Ahdc1 T A 4: 133,062,951 V501E possibly damaging Het
Alpk2 A T 18: 65,305,390 D1444E probably damaging Het
Btaf1 T G 19: 36,997,495 probably null Het
Cacnb2 A G 2: 14,985,706 H489R possibly damaging Het
Ccdc162 C A 10: 41,579,143 K398N probably damaging Het
Cd79b G T 11: 106,312,433 S145R probably damaging Het
Cdh11 T A 8: 102,668,019 N264Y probably damaging Het
Celsr1 T C 15: 85,901,597 D2892G probably benign Het
Chuk A G 19: 44,103,766 probably benign Het
Clk3 T C 9: 57,751,126 probably benign Het
Dcaf8 A T 1: 172,172,509 D78V possibly damaging Het
Dctn1 A G 6: 83,183,089 T87A probably damaging Het
Ddx50 T C 10: 62,616,249 N732D unknown Het
Dnah5 A T 15: 28,311,143 Y1756F possibly damaging Het
Dock3 A T 9: 106,969,856 V858E probably damaging Het
Fer1l4 A G 2: 156,024,070 F1566S probably benign Het
Fpr-rs7 T C 17: 20,113,854 I125V probably benign Het
Fuca2 C T 10: 13,506,027 P228L probably benign Het
Galntl6 A G 8: 58,535,984 F57L probably benign Het
Gigyf2 T A 1: 87,407,727 probably benign Het
Gm16505 A T 13: 3,361,329 noncoding transcript Het
Gm4781 T C 10: 100,396,777 noncoding transcript Het
Gm9956 T A 10: 56,745,543 Y100* probably null Het
Gpr137c T A 14: 45,246,349 C178S probably damaging Het
Gpr83 A G 9: 14,868,644 R331G probably benign Het
Hlcs T A 16: 94,131,852 H851L probably damaging Het
Kbtbd6 C A 14: 79,451,884 Y6* probably null Het
Kif23 T C 9: 61,925,032 R610G possibly damaging Het
Kifc3 G A 8: 95,105,733 T487I probably damaging Het
Klra5 A C 6: 129,908,796 D133E possibly damaging Het
Klra6 T C 6: 130,022,705 E100G probably damaging Het
Klre1 T A 6: 129,585,568 probably benign Het
Lancl1 C T 1: 67,009,910 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Man1b1 A G 2: 25,338,155 I146V possibly damaging Het
Map4k5 T A 12: 69,874,264 probably benign Het
Mast3 A G 8: 70,781,321 S178P probably damaging Het
Mau2 A G 8: 70,023,612 probably null Het
Mkrn2 A T 6: 115,614,651 N312Y probably damaging Het
Mrvi1 T C 7: 110,876,900 S615G probably benign Het
Myh1 A G 11: 67,202,533 E150G probably damaging Het
Myo7b T A 18: 31,961,825 probably null Het
Nyap1 A G 5: 137,735,298 V491A probably damaging Het
Olfr1284 A G 2: 111,379,293 M98V probably damaging Het
Olfr484 T C 7: 108,124,734 I176M probably benign Het
Olfr518 A T 7: 108,881,533 N24K probably damaging Het
Olfr954 T C 9: 39,461,532 F34L probably damaging Het
Oxsm A T 14: 16,240,893 H385Q probably damaging Het
Pbld2 T C 10: 63,056,811 S242P probably damaging Het
Pdzd7 T C 19: 45,029,305 Y675C probably damaging Het
Pnkd T A 1: 74,351,541 H266Q probably damaging Het
Rbfox2 A G 15: 77,099,279 S141P probably benign Het
Rdx A G 9: 52,068,218 T214A probably benign Het
Ripor2 A T 13: 24,680,644 E219V probably damaging Het
Rufy2 G A 10: 63,011,844 probably benign Het
Slf2 T A 19: 44,975,726 probably benign Het
Snrnp200 G T 2: 127,226,145 probably benign Het
Snx7 T A 3: 117,829,671 probably benign Het
Stt3a T C 9: 36,735,512 I602V probably damaging Het
Tacr3 G A 3: 134,855,000 probably null Het
Tcerg1 C T 18: 42,571,840 T978M probably damaging Het
Tcf7l1 G T 6: 72,788,269 P126Q possibly damaging Het
Trank1 A G 9: 111,365,488 D860G probably damaging Het
Try4 T C 6: 41,304,367 L81P probably benign Het
Ucp1 T C 8: 83,297,847 probably benign Het
Ugt2b38 G A 5: 87,420,452 A328V probably damaging Het
Zfc3h1 A G 10: 115,410,632 T875A probably benign Het
Zfp11 A G 5: 129,657,264 S378P probably damaging Het
Zfp984 T A 4: 147,756,232 N54I probably damaging Het
Other mutations in Wfikkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1484:Wfikkn1 UTSW 17 25877791 missense probably benign 0.01
R1545:Wfikkn1 UTSW 17 25878591 missense probably damaging 1.00
R3689:Wfikkn1 UTSW 17 25878718 missense probably damaging 1.00
R4735:Wfikkn1 UTSW 17 25878393 missense possibly damaging 0.86
R5553:Wfikkn1 UTSW 17 25878494 missense possibly damaging 0.72
R5938:Wfikkn1 UTSW 17 25878912 missense probably damaging 1.00
R6465:Wfikkn1 UTSW 17 25878718 missense probably damaging 1.00
R7516:Wfikkn1 UTSW 17 25878046 missense probably damaging 1.00
R7566:Wfikkn1 UTSW 17 25878378 missense probably damaging 1.00
R8205:Wfikkn1 UTSW 17 25878097 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGTTCACAAGCCTTCTTCTCG -3'
(R):5'- CATGACATTCCCAGCCCTCAGATG -3'

Sequencing Primer
(F):5'- ACCCATGATGACCAGTGGC -3'
(R):5'- CCAGCCCTCAGATGTGATG -3'
Posted On2013-09-03