Incidental Mutation 'R0731:Wfikkn1'
ID 67594
Institutional Source Beutler Lab
Gene Symbol Wfikkn1
Ensembl Gene ENSMUSG00000071192
Gene Name WAP, FS, Ig, KU, and NTR-containing protein 1
Synonyms Gasp2
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.223) question?
Stock # R0731 (G1)
Quality Score 142
Status Validated
Chromosome 17
Chromosomal Location 26096602-26099832 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26096991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 444 (R444S)
Ref Sequence ENSEMBL: ENSMUSP00000093141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000026827] [ENSMUST00000095487] [ENSMUST00000110456] [ENSMUST00000163356] [ENSMUST00000166146] [ENSMUST00000176696] [ENSMUST00000169308] [ENSMUST00000167626] [ENSMUST00000179998] [ENSMUST00000169085]
AlphaFold Q8R0S6
Predicted Effect probably benign
Transcript: ENSMUST00000026826
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026827
SMART Domains Protein: ENSMUSP00000026827
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 203 7.4e-95 PFAM
Pfam:Methyltransf_25 31 133 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095487
AA Change: R444S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093141
Gene: ENSMUSG00000071192
AA Change: R444S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 32 82 4.04e-3 SMART
KAZAL 119 161 1.96e-2 SMART
IGc2 202 274 2.54e-14 SMART
KU 301 356 4.2e-3 SMART
KU 361 414 1.82e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110456
SMART Domains Protein: ENSMUSP00000106086
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 78 8.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably benign
Transcript: ENSMUST00000176696
SMART Domains Protein: ENSMUSP00000135083
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
WAP 2 48 8.8e-2 SMART
KAZAL 85 127 1.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169308
SMART Domains Protein: ENSMUSP00000126198
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 194 5.6e-86 PFAM
Pfam:Methyltransf_25 31 133 4.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167626
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179998
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169085
SMART Domains Protein: ENSMUSP00000125990
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 65 6.5e-29 PFAM
Pfam:DUF938 64 106 3.5e-17 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted multidomain protein consisting of a signal peptide, a WAP domain, a follistatin domain, an immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. These domains have been implicated frequently in inhibition of various types of proteases, suggesting that the encoded protein may be a multivalent protease inhibitor and may control the action of multiple types of serine proteases as well as metalloproteinases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show partial penetrance of posteriorly directed homeotic transformations throughout the axial skeleton, impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Wfikkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1484:Wfikkn1 UTSW 17 26,096,765 (GRCm39) missense probably benign 0.01
R1545:Wfikkn1 UTSW 17 26,097,565 (GRCm39) missense probably damaging 1.00
R3689:Wfikkn1 UTSW 17 26,097,692 (GRCm39) missense probably damaging 1.00
R4735:Wfikkn1 UTSW 17 26,097,367 (GRCm39) missense possibly damaging 0.86
R5553:Wfikkn1 UTSW 17 26,097,468 (GRCm39) missense possibly damaging 0.72
R5938:Wfikkn1 UTSW 17 26,097,886 (GRCm39) missense probably damaging 1.00
R6465:Wfikkn1 UTSW 17 26,097,692 (GRCm39) missense probably damaging 1.00
R7516:Wfikkn1 UTSW 17 26,097,020 (GRCm39) missense probably damaging 1.00
R7566:Wfikkn1 UTSW 17 26,097,352 (GRCm39) missense probably damaging 1.00
R8205:Wfikkn1 UTSW 17 26,097,071 (GRCm39) missense probably benign 0.00
R9168:Wfikkn1 UTSW 17 26,097,145 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTTCACAAGCCTTCTTCTCG -3'
(R):5'- CATGACATTCCCAGCCCTCAGATG -3'

Sequencing Primer
(F):5'- ACCCATGATGACCAGTGGC -3'
(R):5'- CCAGCCCTCAGATGTGATG -3'
Posted On 2013-09-03