Incidental Mutation 'R8866:Polr3b'
ID 675940
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84695691 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 810 (D810E)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably benign
Transcript: ENSMUST00000077175
AA Change: D810E

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: D810E

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Arhgap45 C A 10: 80,017,916 P88Q probably damaging Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Dbr1 T A 9: 99,578,444 L109* probably null Het
Dchs1 G T 7: 105,755,390 N2648K probably benign Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dlgap1 A T 17: 70,516,440 H140L probably damaging Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Eloa A C 4: 136,010,227 probably null Het
Epha7 A G 4: 28,821,614 I260V probably benign Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Fstl4 A G 11: 53,072,406 E205G possibly damaging Het
Gm5592 A T 7: 41,288,822 R509S possibly damaging Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Hgs A G 11: 120,469,638 N54S probably benign Het
Hydin G A 8: 110,582,147 V4022M possibly damaging Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Kctd4 A G 14: 75,963,025 I145M probably benign Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc10 T A 10: 117,045,953 N177K probably damaging Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Ndel1 A G 11: 68,843,819 probably null Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr387-ps1 A G 11: 73,664,999 Y130C probably damaging Het
Olfr392 A T 11: 73,814,411 S224T probably damaging Het
Olfr644 A T 7: 104,068,912 S40T probably damaging Het
Otop2 A G 11: 115,329,528 D398G probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Ppl T A 16: 5,102,347 T395S probably benign Het
Ptprm G A 17: 66,809,635 A883V probably benign Het
Rapgef6 G A 11: 54,552,874 probably null Het
Rbm12 A T 2: 156,096,773 Y526* probably null Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Setd4 A G 16: 93,590,073 F246L probably damaging Het
Shank2 A G 7: 144,411,249 S865G probably benign Het
Skint6 T C 4: 112,854,453 N956D probably benign Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Tank T A 2: 61,578,661 S7R probably benign Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tmem5 A G 10: 122,089,048 Y250H probably damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Tor4a T C 2: 25,194,953 M313V probably benign Het
Tpd52l2 A G 2: 181,513,068 D192G probably damaging Het
Trim29 T C 9: 43,311,648 V258A probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Ttn T C 2: 76,762,331 E20819G probably damaging Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Unc80 G A 1: 66,590,229 G1295E probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Vwa5b1 T G 4: 138,600,317 E316A probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Zfp931 A T 2: 178,068,385 C69* probably null Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R7657:Polr3b UTSW 10 84655991 missense probably damaging 1.00
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAAGTGGCTTATTGAGTACCAC -3'
(R):5'- GAAAATGACCACACTGGCTG -3'

Sequencing Primer
(F):5'- GTGGCTTATTGAGTACCACAAATCC -3'
(R):5'- TGACCACACTGGCTGAATGTAG -3'
Posted On 2021-07-15