Incidental Mutation 'R8866:Rapgef6'
ID 675944
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission 068742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 54443700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108895] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207429
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 59,914,511 (GRCm39) T38I probably benign Het
Arhgap1 G T 2: 91,499,744 (GRCm39) S293I probably benign Het
Arhgap45 C A 10: 79,853,750 (GRCm39) P88Q probably damaging Het
Atg9a A C 1: 75,161,867 (GRCm39) F560V probably damaging Het
Btaf1 T A 19: 36,935,901 (GRCm39) N230K probably benign Het
Ccne1 A C 7: 37,800,046 (GRCm39) H179Q probably benign Het
Dbr1 T A 9: 99,460,497 (GRCm39) L109* probably null Het
Dchs1 G T 7: 105,404,597 (GRCm39) N2648K probably benign Het
Ddx47 A G 6: 135,000,356 (GRCm39) K451E probably benign Het
Dlgap1 A T 17: 70,823,435 (GRCm39) H140L probably damaging Het
Dnah11 T A 12: 118,156,107 (GRCm39) H181L probably benign Het
Dync1h1 T C 12: 110,602,333 (GRCm39) C2074R probably damaging Het
Ell2 A T 13: 75,917,793 (GRCm39) Q574H probably damaging Het
Eloa A C 4: 135,737,538 (GRCm39) probably null Het
Epha7 A G 4: 28,821,614 (GRCm39) I260V probably benign Het
Fbp2 T C 13: 62,989,709 (GRCm39) K199R probably benign Het
Fetub A T 16: 22,758,321 (GRCm39) E368V possibly damaging Het
Fsip2 A G 2: 82,810,521 (GRCm39) Q2280R probably benign Het
Fstl4 A G 11: 52,963,233 (GRCm39) E205G possibly damaging Het
Gm5592 A T 7: 40,938,246 (GRCm39) R509S possibly damaging Het
Gpld1 A G 13: 25,170,890 (GRCm39) T794A probably benign Het
Gsk3b A G 16: 38,004,900 (GRCm39) Y157C probably damaging Het
Hgs A G 11: 120,360,464 (GRCm39) N54S probably benign Het
Hydin G A 8: 111,308,779 (GRCm39) V4022M possibly damaging Het
Kank1 T C 19: 25,388,702 (GRCm39) S792P possibly damaging Het
Kctd4 A G 14: 76,200,465 (GRCm39) I145M probably benign Het
Klra5 A T 6: 129,880,533 (GRCm39) W212R probably damaging Het
Lrp6 A T 6: 134,445,785 (GRCm39) N1009K probably benign Het
Lrrc10 T A 10: 116,881,858 (GRCm39) N177K probably damaging Het
Lrrc39 T A 3: 116,363,790 (GRCm39) I121N probably damaging Het
Mov10l1 A T 15: 88,896,169 (GRCm39) D671V probably benign Het
Ndel1 A G 11: 68,734,645 (GRCm39) probably null Het
Or10g3 A T 14: 52,610,196 (GRCm39) Y105N probably damaging Het
Or1e27-ps1 A G 11: 73,555,825 (GRCm39) Y130C probably damaging Het
Or1e32 A T 11: 73,705,237 (GRCm39) S224T probably damaging Het
Or51a43 A T 7: 103,718,119 (GRCm39) S40T probably damaging Het
Otop2 A G 11: 115,220,354 (GRCm39) D398G probably benign Het
Pkd1 T C 17: 24,792,051 (GRCm39) V1246A probably damaging Het
Polr3b T A 10: 84,531,555 (GRCm39) D810E probably benign Het
Ppl T A 16: 4,920,211 (GRCm39) T395S probably benign Het
Ptprm G A 17: 67,116,630 (GRCm39) A883V probably benign Het
Rbm12 A T 2: 155,938,693 (GRCm39) Y526* probably null Het
Rbm15b C T 9: 106,763,595 (GRCm39) R191Q probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,229,120 (GRCm39) probably benign Het
Rxylt1 A G 10: 121,924,953 (GRCm39) Y250H probably damaging Het
Serpinb6c A T 13: 34,083,309 (GRCm39) I35N probably damaging Het
Setd4 A G 16: 93,386,961 (GRCm39) F246L probably damaging Het
Shank2 A G 7: 143,964,986 (GRCm39) S865G probably benign Het
Skint6 T C 4: 112,711,650 (GRCm39) N956D probably benign Het
Slc30a3 C A 5: 31,245,325 (GRCm39) V332F possibly damaging Het
Smg1 A G 7: 117,806,122 (GRCm39) S240P unknown Het
Tank T A 2: 61,409,005 (GRCm39) S7R probably benign Het
Tecpr1 T C 5: 144,153,117 (GRCm39) E204G possibly damaging Het
Tmem74 A G 15: 43,730,231 (GRCm39) S271P probably damaging Het
Tor4a T C 2: 25,084,965 (GRCm39) M313V probably benign Het
Tpd52l2 A G 2: 181,154,861 (GRCm39) D192G probably damaging Het
Trim29 T C 9: 43,222,945 (GRCm39) V258A probably damaging Het
Ttc39c A T 18: 12,831,003 (GRCm39) S288C probably benign Het
Ttn T C 2: 76,592,675 (GRCm39) E20819G probably damaging Het
Twnk C T 19: 45,000,272 (GRCm39) Q663* probably null Het
Ucn T A 5: 31,295,857 (GRCm39) Q3L probably benign Het
Unc80 G A 1: 66,629,388 (GRCm39) G1295E probably benign Het
Usp9y C T Y: 1,395,758 (GRCm39) R492H probably damaging Het
Vars1 T C 17: 35,234,620 (GRCm39) S1150P probably benign Het
Vwa5b1 T G 4: 138,327,628 (GRCm39) E316A probably damaging Het
Zc3h7b G A 15: 81,656,681 (GRCm39) R166Q probably benign Het
Zfp839 A G 12: 110,834,848 (GRCm39) E701G probably benign Het
Zfp931 A T 2: 177,710,178 (GRCm39) C69* probably null Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAGAATGTAGTCTATGCTTTGC -3'
(R):5'- CTCCTGCCAAAATGTGCAATTGC -3'

Sequencing Primer
(F):5'- TGCATTCATATTGAATCCGCAC -3'
(R):5'- CTGCAAAAATCCTAGCACT -3'
Posted On 2021-07-15