Incidental Mutation 'R8866:Zfp839'
ID675951
Institutional Source Beutler Lab
Gene Symbol Zfp839
Ensembl Gene ENSMUSG00000021271
Gene Namezinc finger protein 839
Synonyms2810455K09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8866 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location110850253-110869996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110868414 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 701 (E701G)
Ref Sequence ENSEMBL: ENSMUSP00000131841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043716] [ENSMUST00000170060] [ENSMUST00000220607] [ENSMUST00000222460]
Predicted Effect probably benign
Transcript: ENSMUST00000043716
SMART Domains Protein: ENSMUSP00000035245
Gene: ENSMUSG00000021276

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170060
AA Change: E701G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271
AA Change: E701G

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220607
Predicted Effect probably benign
Transcript: ENSMUST00000222460
AA Change: E625G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Arhgap45 C A 10: 80,017,916 P88Q probably damaging Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Dbr1 T A 9: 99,578,444 L109* probably null Het
Dchs1 G T 7: 105,755,390 N2648K probably benign Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dlgap1 A T 17: 70,516,440 H140L probably damaging Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Eloa A C 4: 136,010,227 probably null Het
Epha7 A G 4: 28,821,614 I260V probably benign Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Fstl4 A G 11: 53,072,406 E205G possibly damaging Het
Gm5592 A T 7: 41,288,822 R509S possibly damaging Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Hgs A G 11: 120,469,638 N54S probably benign Het
Hydin G A 8: 110,582,147 V4022M possibly damaging Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Kctd4 A G 14: 75,963,025 I145M probably benign Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc10 T A 10: 117,045,953 N177K probably damaging Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Ndel1 A G 11: 68,843,819 probably null Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr387-ps1 A G 11: 73,664,999 Y130C probably damaging Het
Olfr392 A T 11: 73,814,411 S224T probably damaging Het
Olfr644 A T 7: 104,068,912 S40T probably damaging Het
Otop2 A G 11: 115,329,528 D398G probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Polr3b T A 10: 84,695,691 D810E probably benign Het
Ppl T A 16: 5,102,347 T395S probably benign Het
Ptprm G A 17: 66,809,635 A883V probably benign Het
Rapgef6 G A 11: 54,552,874 probably null Het
Rbm12 A T 2: 156,096,773 Y526* probably null Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Serpinb6c A T 13: 33,899,326 I35N probably damaging Het
Setd4 A G 16: 93,590,073 F246L probably damaging Het
Shank2 A G 7: 144,411,249 S865G probably benign Het
Skint6 T C 4: 112,854,453 N956D probably benign Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Tank T A 2: 61,578,661 S7R probably benign Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tmem5 A G 10: 122,089,048 Y250H probably damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Tor4a T C 2: 25,194,953 M313V probably benign Het
Tpd52l2 A G 2: 181,513,068 D192G probably damaging Het
Trim29 T C 9: 43,311,648 V258A probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Ttn T C 2: 76,762,331 E20819G probably damaging Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Unc80 G A 1: 66,590,229 G1295E probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Vwa5b1 T G 4: 138,600,317 E316A probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp931 A T 2: 178,068,385 C69* probably null Het
Other mutations in Zfp839
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp839 APN 12 110865007 critical splice donor site probably null
IGL00941:Zfp839 APN 12 110860948 missense probably damaging 1.00
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0013:Zfp839 UTSW 12 110868386 missense possibly damaging 0.66
R0109:Zfp839 UTSW 12 110860874 missense possibly damaging 0.92
R0116:Zfp839 UTSW 12 110858769 intron probably benign
R1219:Zfp839 UTSW 12 110868273 missense possibly damaging 0.63
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1406:Zfp839 UTSW 12 110866310 missense probably damaging 0.99
R1434:Zfp839 UTSW 12 110860899 missense probably benign 0.08
R1653:Zfp839 UTSW 12 110855250 missense probably benign 0.02
R1754:Zfp839 UTSW 12 110855457 missense probably damaging 0.98
R2182:Zfp839 UTSW 12 110868338 missense probably damaging 1.00
R3765:Zfp839 UTSW 12 110855163 missense probably benign 0.22
R3981:Zfp839 UTSW 12 110866331 missense probably damaging 0.97
R4756:Zfp839 UTSW 12 110855201 missense possibly damaging 0.92
R5088:Zfp839 UTSW 12 110868176 missense probably damaging 0.99
R5394:Zfp839 UTSW 12 110855586 missense probably benign 0.05
R5619:Zfp839 UTSW 12 110864036 missense probably damaging 1.00
R6856:Zfp839 UTSW 12 110866761 nonsense probably null
R7661:Zfp839 UTSW 12 110868792 missense probably benign 0.32
R7860:Zfp839 UTSW 12 110855626 missense probably damaging 1.00
R8022:Zfp839 UTSW 12 110855098 missense probably damaging 1.00
R8855:Zfp839 UTSW 12 110868414 missense probably benign 0.06
R8896:Zfp839 UTSW 12 110868843 missense probably damaging 1.00
Z1177:Zfp839 UTSW 12 110866784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTAGTGACAGAAATGCACCAC -3'
(R):5'- TTATGGAGTGGAACGGCTGC -3'

Sequencing Primer
(F):5'- TAGGAATGGCTCTGCAGA -3'
(R):5'- AGCCTCTGCCAGAAGGACATG -3'
Posted On2021-07-15