Incidental Mutation 'R8866:Serpinb6c'
ID 675954
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms Spi3C, SPIC, ovalbumin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R8866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33879816-33905708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33899326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 35 (I35N)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184] [ENSMUST00000222216]
AlphaFold W4VSP4
Predicted Effect probably damaging
Transcript: ENSMUST00000110273
AA Change: I35N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: I35N

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172184
AA Change: I35N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: I35N

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222216
AA Change: I35N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Arhgap45 C A 10: 80,017,916 P88Q probably damaging Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Dbr1 T A 9: 99,578,444 L109* probably null Het
Dchs1 G T 7: 105,755,390 N2648K probably benign Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dlgap1 A T 17: 70,516,440 H140L probably damaging Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Eloa A C 4: 136,010,227 probably null Het
Epha7 A G 4: 28,821,614 I260V probably benign Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Fstl4 A G 11: 53,072,406 E205G possibly damaging Het
Gm5592 A T 7: 41,288,822 R509S possibly damaging Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Hgs A G 11: 120,469,638 N54S probably benign Het
Hydin G A 8: 110,582,147 V4022M possibly damaging Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Kctd4 A G 14: 75,963,025 I145M probably benign Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc10 T A 10: 117,045,953 N177K probably damaging Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Ndel1 A G 11: 68,843,819 probably null Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr387-ps1 A G 11: 73,664,999 Y130C probably damaging Het
Olfr392 A T 11: 73,814,411 S224T probably damaging Het
Olfr644 A T 7: 104,068,912 S40T probably damaging Het
Otop2 A G 11: 115,329,528 D398G probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Polr3b T A 10: 84,695,691 D810E probably benign Het
Ppl T A 16: 5,102,347 T395S probably benign Het
Ptprm G A 17: 66,809,635 A883V probably benign Het
Rapgef6 G A 11: 54,552,874 probably null Het
Rbm12 A T 2: 156,096,773 Y526* probably null Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Setd4 A G 16: 93,590,073 F246L probably damaging Het
Shank2 A G 7: 144,411,249 S865G probably benign Het
Skint6 T C 4: 112,854,453 N956D probably benign Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Tank T A 2: 61,578,661 S7R probably benign Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tmem5 A G 10: 122,089,048 Y250H probably damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Tor4a T C 2: 25,194,953 M313V probably benign Het
Tpd52l2 A G 2: 181,513,068 D192G probably damaging Het
Trim29 T C 9: 43,311,648 V258A probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Ttn T C 2: 76,762,331 E20819G probably damaging Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Unc80 G A 1: 66,590,229 G1295E probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Vwa5b1 T G 4: 138,600,317 E316A probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Zfp931 A T 2: 178,068,385 C69* probably null Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8121:Serpinb6c UTSW 13 33880218 missense probably benign 0.38
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8745:Serpinb6c UTSW 13 33880719 missense probably benign 0.06
R8855:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R9412:Serpinb6c UTSW 13 33897388 missense not run
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATCACATCCTGCCCATCATG -3'
(R):5'- TGTGCCTTGTTCACTGAGTC -3'

Sequencing Primer
(F):5'- ATCATGTCTCCAGTCACACCC -3'
(R):5'- GTTCACTGAGTCAGAGTATCACAGTG -3'
Posted On 2021-07-15