Incidental Mutation 'R8867:Pikfyve'
ID 675975
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms Pip5k3
MMRRC Submission 068682-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8867 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 65186683-65278695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65244417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 738 (Y738N)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y693N

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: Y738N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y738N

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Meta Mutation Damage Score 0.4313 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 (GRCm38) S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 (GRCm38) S253P probably damaging Het
Acbd5 T C 2: 23,080,358 (GRCm38) M97T possibly damaging Het
Aire T C 10: 78,037,975 (GRCm38) E300G probably damaging Het
Ano1 A G 7: 144,669,660 (GRCm38) S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 (GRCm38) N732D probably benign Het
Apcs A T 1: 172,894,437 (GRCm38) L114Q possibly damaging Het
Apmap T C 2: 150,589,966 (GRCm38) probably benign Het
Ark2c T C 18: 77,475,486 (GRCm38) E159G possibly damaging Het
Asxl3 C A 18: 22,516,490 (GRCm38) T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 (GRCm38) T388A probably damaging Het
B3galt9 A G 2: 34,838,624 (GRCm38) D145G probably damaging Het
Bcl2a1a A T 9: 88,957,450 (GRCm38) I134L probably damaging Het
Chd6 G A 2: 161,021,069 (GRCm38) A444V probably benign Het
Cmbl C A 15: 31,581,927 (GRCm38) H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 (GRCm38) I262N probably damaging Het
Col6a3 C T 1: 90,787,951 (GRCm38) R2260H unknown Het
Cracr2a T A 6: 127,629,773 (GRCm38) L260* probably null Het
Csmd2 A G 4: 128,557,676 (GRCm38) Y3409C Het
Cyp4b1 C T 4: 115,635,972 (GRCm38) R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 (GRCm38) A380V probably benign Het
Dnah6 A G 6: 73,021,148 (GRCm38) L4097P probably damaging Het
Dppa3 G A 6: 122,628,643 (GRCm38) R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 (GRCm38) R311H probably benign Het
Fhad1 T C 4: 141,929,574 (GRCm38) R90G probably damaging Het
Fitm2 A T 2: 163,469,682 (GRCm38) W204R possibly damaging Het
Gatb T A 3: 85,604,409 (GRCm38) L157H probably damaging Het
Gm5111 G A 6: 48,589,695 (GRCm38) probably null Het
Gm7298 A C 6: 121,771,829 (GRCm38) I688L probably benign Het
Hecw1 T C 13: 14,247,690 (GRCm38) probably null Het
Ift122 T A 6: 115,880,671 (GRCm38) V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 (GRCm38) I121F possibly damaging Het
Kif21a A G 15: 90,968,179 (GRCm38) V902A probably damaging Het
Klhl38 T C 15: 58,315,039 (GRCm38) M512V probably benign Het
Klk1b1 A C 7: 43,970,323 (GRCm38) N102T probably damaging Het
Lama4 T A 10: 39,048,000 (GRCm38) L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 (GRCm38) Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 (GRCm38) D740V probably damaging Het
Mapk7 G T 11: 61,493,806 (GRCm38) P25T probably benign Het
Mcm3ap C A 10: 76,470,704 (GRCm38) A217D probably benign Het
Mucl3 A T 17: 35,637,980 (GRCm38) F242L probably benign Het
Ncaph2 A G 15: 89,370,402 (GRCm38) E406G probably benign Het
Ncor2 T C 5: 125,102,675 (GRCm38) I69V unknown Het
Nfatc3 A G 8: 106,079,008 (GRCm38) S170G probably damaging Het
Nptn G A 9: 58,618,981 (GRCm38) R137Q probably damaging Het
Nsd1 A T 13: 55,282,757 (GRCm38) K1581N probably damaging Het
Or1q1 T C 2: 36,997,679 (GRCm38) Y290H probably damaging Het
Or2t43 A G 11: 58,566,736 (GRCm38) L203P probably damaging Het
Or51l4 G A 7: 103,754,686 (GRCm38) Q300* probably null Het
Or52ab2 T A 7: 103,321,242 (GRCm38) L277Q Het
Or5be3 G T 2: 87,033,459 (GRCm38) T254K probably damaging Het
Or6c211 A T 10: 129,669,759 (GRCm38) C253* probably null Het
Pdcl T C 2: 37,352,336 (GRCm38) E134G probably damaging Het
Pkd1 A G 17: 24,573,833 (GRCm38) D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 (GRCm38) N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 (GRCm38) probably benign Het
Prkn A G 17: 11,237,561 (GRCm38) T91A probably benign Het
Rgs18 T A 1: 144,753,960 (GRCm38) D187V probably damaging Het
Ripor2 C T 13: 24,638,777 (GRCm38) probably benign Het
Rpl3l G A 17: 24,735,481 (GRCm38) G172D probably damaging Het
Sdf4 A G 4: 156,009,302 (GRCm38) T298A probably damaging Het
Skic3 C T 13: 76,131,309 (GRCm38) S620L probably damaging Het
Slc17a3 T C 13: 23,855,960 (GRCm38) V327A Het
Slc4a1ap T A 5: 31,550,715 (GRCm38) F677L probably benign Het
Stoml2 A G 4: 43,028,256 (GRCm38) V324A probably benign Het
Syne2 A G 12: 75,942,846 (GRCm38) Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 (GRCm38) N481D possibly damaging Het
Tert T C 13: 73,628,447 (GRCm38) M439T probably benign Het
Thsd7a A T 6: 12,338,687 (GRCm38) D1181E Het
Tln2 G A 9: 67,330,550 (GRCm38) T33I probably damaging Het
Top3a A G 11: 60,742,655 (GRCm38) S872P probably benign Het
Trim10 T C 17: 36,870,156 (GRCm38) L93P probably benign Het
Trpc7 C T 13: 56,860,933 (GRCm38) S307N probably benign Het
Ttn A T 2: 76,810,083 (GRCm38) V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 (GRCm38) S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 (GRCm38) S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 (GRCm38) R166Q probably benign Het
Zfp683 C T 4: 134,058,684 (GRCm38) T374I probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,260,121 (GRCm38) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,251,635 (GRCm38) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,258,869 (GRCm38) nonsense probably null
IGL01759:Pikfyve APN 1 65,253,353 (GRCm38) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,223,640 (GRCm38) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,264,365 (GRCm38) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,238,544 (GRCm38) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,272,571 (GRCm38) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,246,397 (GRCm38) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,251,678 (GRCm38) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,256,021 (GRCm38) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,252,569 (GRCm38) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,244,504 (GRCm38) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,251,612 (GRCm38) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,264,376 (GRCm38) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,230,855 (GRCm38) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,234,272 (GRCm38) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,250,194 (GRCm38) nonsense probably null
IGL02890:Pikfyve APN 1 65,230,797 (GRCm38) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,252,467 (GRCm38) nonsense probably null
IGL03294:Pikfyve APN 1 65,247,067 (GRCm38) missense probably damaging 1.00
falcon UTSW 1 65,196,741 (GRCm38) missense probably damaging 1.00
oompa UTSW 1 65,196,706 (GRCm38) missense probably damaging 1.00
wonka UTSW 1 65,196,706 (GRCm38) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,202,916 (GRCm38) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,215,929 (GRCm38) splice site probably benign
R0196:Pikfyve UTSW 1 65,256,072 (GRCm38) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,262,905 (GRCm38) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,246,331 (GRCm38) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,264,399 (GRCm38) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,196,706 (GRCm38) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,196,706 (GRCm38) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,219,899 (GRCm38) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,253,523 (GRCm38) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,253,397 (GRCm38) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,202,830 (GRCm38) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,265,824 (GRCm38) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,246,959 (GRCm38) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,202,830 (GRCm38) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,271,311 (GRCm38) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,251,666 (GRCm38) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,251,666 (GRCm38) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,224,201 (GRCm38) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,262,977 (GRCm38) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,265,284 (GRCm38) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,252,548 (GRCm38) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,246,370 (GRCm38) missense probably benign
R1773:Pikfyve UTSW 1 65,192,271 (GRCm38) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,252,557 (GRCm38) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,258,798 (GRCm38) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,192,295 (GRCm38) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,246,708 (GRCm38) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,222,357 (GRCm38) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,253,353 (GRCm38) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,267,855 (GRCm38) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,246,676 (GRCm38) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,253,517 (GRCm38) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,245,758 (GRCm38) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,244,420 (GRCm38) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,230,845 (GRCm38) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,196,681 (GRCm38) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,190,520 (GRCm38) unclassified probably benign
R4542:Pikfyve UTSW 1 65,244,430 (GRCm38) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,192,192 (GRCm38) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,234,262 (GRCm38) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,250,273 (GRCm38) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,250,273 (GRCm38) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,250,273 (GRCm38) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,267,846 (GRCm38) missense probably benign
R4716:Pikfyve UTSW 1 65,246,476 (GRCm38) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,272,515 (GRCm38) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,267,846 (GRCm38) missense probably benign
R4785:Pikfyve UTSW 1 65,267,846 (GRCm38) missense probably benign
R4805:Pikfyve UTSW 1 65,268,800 (GRCm38) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,196,741 (GRCm38) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,246,590 (GRCm38) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,253,407 (GRCm38) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,224,117 (GRCm38) intron probably benign
R5265:Pikfyve UTSW 1 65,267,829 (GRCm38) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,196,699 (GRCm38) nonsense probably null
R5384:Pikfyve UTSW 1 65,244,409 (GRCm38) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,265,268 (GRCm38) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,235,033 (GRCm38) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,252,495 (GRCm38) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,253,407 (GRCm38) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,273,730 (GRCm38) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,256,088 (GRCm38) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,216,028 (GRCm38) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,202,737 (GRCm38) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,253,438 (GRCm38) nonsense probably null
R6026:Pikfyve UTSW 1 65,272,697 (GRCm38) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,272,571 (GRCm38) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,264,345 (GRCm38) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,264,345 (GRCm38) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,216,043 (GRCm38) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,253,532 (GRCm38) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,202,925 (GRCm38) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,262,953 (GRCm38) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,265,781 (GRCm38) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,258,843 (GRCm38) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,252,530 (GRCm38) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,246,663 (GRCm38) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,234,361 (GRCm38) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,246,854 (GRCm38) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,247,205 (GRCm38) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,244,426 (GRCm38) nonsense probably null
R7558:Pikfyve UTSW 1 65,272,623 (GRCm38) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,267,877 (GRCm38) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,269,942 (GRCm38) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,255,134 (GRCm38) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,255,134 (GRCm38) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,265,789 (GRCm38) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,246,395 (GRCm38) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,253,342 (GRCm38) splice site probably benign
R8307:Pikfyve UTSW 1 65,245,735 (GRCm38) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,215,996 (GRCm38) missense possibly damaging 0.94
R8936:Pikfyve UTSW 1 65,271,268 (GRCm38) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,246,970 (GRCm38) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,205,587 (GRCm38) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,244,400 (GRCm38) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,246,080 (GRCm38) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,196,739 (GRCm38) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,252,560 (GRCm38) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,252,560 (GRCm38) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,260,029 (GRCm38) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,268,742 (GRCm38) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,264,402 (GRCm38) missense probably benign
R9605:Pikfyve UTSW 1 65,264,402 (GRCm38) missense probably benign
R9686:Pikfyve UTSW 1 65,252,456 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGATTGTTAGGGCCTGAAAATC -3'
(R):5'- GCTGCATACCTACCATACATGC -3'

Sequencing Primer
(F):5'- AGAGGGTGAAACTTTTCCTAAAAC -3'
(R):5'- GAGTAATGCCATGTTCCAGT -3'
Posted On 2021-07-15