Incidental Mutation 'R8867:Pikfyve'
ID 675975
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms Pip5k3
MMRRC Submission
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8867 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 65186683-65278695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65244417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 738 (Y738N)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y693N

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: Y738N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y738N

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Meta Mutation Damage Score 0.4313 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 S253P probably damaging Het
Acbd5 T C 2: 23,080,358 M97T possibly damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ano1 A G 7: 144,669,660 S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 N732D probably benign Het
Apcs A T 1: 172,894,437 L114Q possibly damaging Het
Apmap T C 2: 150,589,966 probably benign Het
Asxl3 C A 18: 22,516,490 T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 T388A probably damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Cmbl C A 15: 31,581,927 H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 I262N probably damaging Het
Col6a3 C T 1: 90,787,951 R2260H unknown Het
Cracr2a T A 6: 127,629,773 L260* probably null Het
Csmd2 A G 4: 128,557,676 Y3409C Het
Cyp4b1 C T 4: 115,635,972 R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dnah6 A G 6: 73,021,148 L4097P probably damaging Het
Dpcr1 A T 17: 35,637,980 F242L probably benign Het
Dppa3 G A 6: 122,628,643 R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 R311H probably benign Het
Fhad1 T C 4: 141,929,574 R90G probably damaging Het
Fitm2 A T 2: 163,469,682 W204R possibly damaging Het
Gatb T A 3: 85,604,409 L157H probably damaging Het
Gm34653 A G 2: 34,838,624 D145G probably damaging Het
Gm5111 G A 6: 48,589,695 probably null Het
Gm7298 A C 6: 121,771,829 I688L probably benign Het
Hecw1 T C 13: 14,247,690 probably null Het
Ift122 T A 6: 115,880,671 V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 I121F possibly damaging Het
Kif21a A G 15: 90,968,179 V902A probably damaging Het
Klhl38 T C 15: 58,315,039 M512V probably benign Het
Klk1b1 A C 7: 43,970,323 N102T probably damaging Het
Lama4 T A 10: 39,048,000 L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 D740V probably damaging Het
Mapk7 G T 11: 61,493,806 P25T probably benign Het
Mcm3ap C A 10: 76,470,704 A217D probably benign Het
Ncaph2 A G 15: 89,370,402 E406G probably benign Het
Ncor2 T C 5: 125,102,675 I69V unknown Het
Nfatc3 A G 8: 106,079,008 S170G probably damaging Het
Nptn G A 9: 58,618,981 R137Q probably damaging Het
Nsd1 A T 13: 55,282,757 K1581N probably damaging Het
Olfr1105 G T 2: 87,033,459 T254K probably damaging Het
Olfr224 A G 11: 58,566,736 L203P probably damaging Het
Olfr357 T C 2: 36,997,679 Y290H probably damaging Het
Olfr597 T A 7: 103,321,242 L277Q Het
Olfr630 G A 7: 103,754,686 Q300* probably null Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Park2 A G 17: 11,237,561 T91A probably benign Het
Pdcl T C 2: 37,352,336 E134G probably damaging Het
Pkd1 A G 17: 24,573,833 D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 probably benign Het
Rgs18 T A 1: 144,753,960 D187V probably damaging Het
Ripor2 C T 13: 24,638,777 probably benign Het
Rnf165 T C 18: 77,475,486 E159G possibly damaging Het
Rpl3l G A 17: 24,735,481 G172D probably damaging Het
Sdf4 A G 4: 156,009,302 T298A probably damaging Het
Slc17a3 T C 13: 23,855,960 V327A Het
Slc4a1ap T A 5: 31,550,715 F677L probably benign Het
Stoml2 A G 4: 43,028,256 V324A probably benign Het
Syne2 A G 12: 75,942,846 Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 N481D possibly damaging Het
Tert T C 13: 73,628,447 M439T probably benign Het
Thsd7a A T 6: 12,338,687 D1181E Het
Tln2 G A 9: 67,330,550 T33I probably damaging Het
Top3a A G 11: 60,742,655 S872P probably benign Het
Trim10 T C 17: 36,870,156 L93P probably benign Het
Trpc7 C T 13: 56,860,933 S307N probably benign Het
Ttc37 C T 13: 76,131,309 S620L probably damaging Het
Ttn A T 2: 76,810,083 V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp683 C T 4: 134,058,684 T374I probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65265789 missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65246395 missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65253342 splice site probably benign
R8307:Pikfyve UTSW 1 65245735 missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65215996 missense possibly damaging 0.94
R8936:Pikfyve UTSW 1 65271268 missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65246970 missense probably benign 0.00
R8995:Pikfyve UTSW 1 65205587 critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65244400 missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65246080 missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65196739 missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65260029 missense probably benign 0.37
R9368:Pikfyve UTSW 1 65268742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGATTGTTAGGGCCTGAAAATC -3'
(R):5'- GCTGCATACCTACCATACATGC -3'

Sequencing Primer
(F):5'- AGAGGGTGAAACTTTTCCTAAAAC -3'
(R):5'- GAGTAATGCCATGTTCCAGT -3'
Posted On 2021-07-15