Incidental Mutation 'R0731:Btaf1'
ID 67598
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene Name B-TFIID TATA-box binding protein associated factor 1
Synonyms E430027O22Rik
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R0731 (G1)
Quality Score 101
Status Validated
Chromosome 19
Chromosomal Location 36903479-36990152 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 36974895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
AlphaFold E9QAE3
Predicted Effect probably null
Transcript: ENSMUST00000099494
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Actg1 A G 11: 120,237,775 (GRCm39) F255S probably damaging Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 36,987,102 (GRCm39) missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36,974,935 (GRCm39) missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36,947,330 (GRCm39) missense probably benign 0.00
IGL00969:Btaf1 APN 19 36,988,652 (GRCm39) splice site probably benign
IGL01325:Btaf1 APN 19 36,982,049 (GRCm39) splice site probably benign
IGL01399:Btaf1 APN 19 36,977,570 (GRCm39) nonsense probably null
IGL02024:Btaf1 APN 19 36,969,826 (GRCm39) splice site probably benign
IGL02471:Btaf1 APN 19 36,977,592 (GRCm39) missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36,955,828 (GRCm39) splice site probably benign
IGL02898:Btaf1 APN 19 36,946,468 (GRCm39) missense probably benign
IGL02995:Btaf1 APN 19 36,958,535 (GRCm39) splice site probably benign
IGL03023:Btaf1 APN 19 36,987,415 (GRCm39) missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36,926,508 (GRCm39) missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36,969,900 (GRCm39) missense probably damaging 1.00
freudenberg UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
Galanos UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
3-1:Btaf1 UTSW 19 36,987,478 (GRCm39) missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36,935,773 (GRCm39) missense probably benign
R0048:Btaf1 UTSW 19 36,980,924 (GRCm39) missense probably benign 0.01
R0117:Btaf1 UTSW 19 36,947,368 (GRCm39) missense probably benign 0.06
R0207:Btaf1 UTSW 19 36,987,048 (GRCm39) nonsense probably null
R0310:Btaf1 UTSW 19 36,981,934 (GRCm39) missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36,966,402 (GRCm39) missense probably benign
R0419:Btaf1 UTSW 19 36,922,629 (GRCm39) missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36,964,053 (GRCm39) missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36,928,586 (GRCm39) splice site probably benign
R0612:Btaf1 UTSW 19 36,946,537 (GRCm39) missense probably damaging 0.99
R0780:Btaf1 UTSW 19 36,966,322 (GRCm39) missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36,968,143 (GRCm39) missense probably benign 0.03
R1104:Btaf1 UTSW 19 36,982,002 (GRCm39) missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36,933,924 (GRCm39) missense probably benign 0.10
R1325:Btaf1 UTSW 19 36,946,562 (GRCm39) missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36,969,854 (GRCm39) missense probably benign 0.00
R1554:Btaf1 UTSW 19 36,973,998 (GRCm39) missense probably benign 0.02
R1649:Btaf1 UTSW 19 36,959,122 (GRCm39) missense probably benign
R1715:Btaf1 UTSW 19 36,946,521 (GRCm39) missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36,972,362 (GRCm39) missense probably benign
R1764:Btaf1 UTSW 19 36,928,518 (GRCm39) missense probably benign 0.12
R1874:Btaf1 UTSW 19 36,957,983 (GRCm39) missense probably benign
R1911:Btaf1 UTSW 19 36,964,030 (GRCm39) missense probably benign
R1933:Btaf1 UTSW 19 36,950,357 (GRCm39) missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36,928,548 (GRCm39) missense probably benign 0.09
R2483:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R2510:Btaf1 UTSW 19 36,979,845 (GRCm39) missense probably benign 0.08
R3623:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3624:Btaf1 UTSW 19 36,958,486 (GRCm39) missense probably benign 0.02
R3801:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3801:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3802:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3802:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R3803:Btaf1 UTSW 19 36,966,373 (GRCm39) missense probably benign 0.00
R3803:Btaf1 UTSW 19 36,963,948 (GRCm39) missense probably benign
R4077:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4079:Btaf1 UTSW 19 36,963,879 (GRCm39) missense probably benign 0.00
R4133:Btaf1 UTSW 19 36,939,138 (GRCm39) missense probably benign 0.00
R4673:Btaf1 UTSW 19 36,955,772 (GRCm39) missense probably benign 0.00
R4731:Btaf1 UTSW 19 36,958,478 (GRCm39) missense probably benign 0.03
R4796:Btaf1 UTSW 19 36,933,828 (GRCm39) missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36,958,448 (GRCm39) missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 36,979,858 (GRCm39) missense probably benign 0.00
R4837:Btaf1 UTSW 19 36,944,185 (GRCm39) missense probably benign
R4925:Btaf1 UTSW 19 36,988,733 (GRCm39) missense probably benign
R4968:Btaf1 UTSW 19 36,947,351 (GRCm39) missense probably null 0.71
R4976:Btaf1 UTSW 19 36,963,979 (GRCm39) missense probably benign
R5001:Btaf1 UTSW 19 36,964,052 (GRCm39) missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 36,980,931 (GRCm39) missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36,968,162 (GRCm39) missense probably benign
R5211:Btaf1 UTSW 19 36,973,962 (GRCm39) missense probably benign 0.32
R5422:Btaf1 UTSW 19 36,928,507 (GRCm39) missense probably benign 0.09
R5429:Btaf1 UTSW 19 36,972,257 (GRCm39) missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36,968,175 (GRCm39) missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36,965,573 (GRCm39) critical splice donor site probably null
R5654:Btaf1 UTSW 19 36,961,015 (GRCm39) missense probably benign 0.35
R5744:Btaf1 UTSW 19 36,981,890 (GRCm39) missense probably benign 0.02
R6082:Btaf1 UTSW 19 36,960,942 (GRCm39) missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36,958,520 (GRCm39) missense probably benign 0.02
R6291:Btaf1 UTSW 19 36,950,408 (GRCm39) missense probably benign 0.00
R6502:Btaf1 UTSW 19 36,961,017 (GRCm39) missense probably benign
R7034:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7036:Btaf1 UTSW 19 36,981,869 (GRCm39) missense probably benign
R7085:Btaf1 UTSW 19 36,950,318 (GRCm39) missense probably benign
R7097:Btaf1 UTSW 19 36,926,502 (GRCm39) missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36,922,714 (GRCm39) missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36,935,782 (GRCm39) missense probably benign 0.02
R7402:Btaf1 UTSW 19 36,980,915 (GRCm39) missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36,946,527 (GRCm39) missense probably damaging 1.00
R7493:Btaf1 UTSW 19 36,987,005 (GRCm39) missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36,955,803 (GRCm39) missense probably benign 0.30
R7888:Btaf1 UTSW 19 36,943,036 (GRCm39) missense probably benign 0.10
R7944:Btaf1 UTSW 19 36,926,565 (GRCm39) missense probably benign
R8062:Btaf1 UTSW 19 36,969,865 (GRCm39) missense probably benign 0.00
R8559:Btaf1 UTSW 19 36,964,273 (GRCm39) missense probably benign 0.00
R8793:Btaf1 UTSW 19 36,958,429 (GRCm39) missense probably benign 0.21
R8855:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R8866:Btaf1 UTSW 19 36,935,901 (GRCm39) missense probably benign
R9016:Btaf1 UTSW 19 36,971,705 (GRCm39) missense probably benign 0.00
R9028:Btaf1 UTSW 19 36,946,508 (GRCm39) missense probably damaging 1.00
R9109:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9172:Btaf1 UTSW 19 36,977,630 (GRCm39) missense probably damaging 0.98
R9298:Btaf1 UTSW 19 36,964,114 (GRCm39) missense probably benign
R9717:Btaf1 UTSW 19 36,922,646 (GRCm39) missense probably benign 0.28
W0251:Btaf1 UTSW 19 36,980,904 (GRCm39) missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36,926,496 (GRCm39) nonsense probably null
Z1088:Btaf1 UTSW 19 36,964,018 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACCTTTggggctggtgagatg -3'
(R):5'- ACTAAATGCTATGCCACCTGGCAAG -3'

Sequencing Primer
(F):5'- gcacccgactgttcttcc -3'
(R):5'- CCTGGATTGGTGTTCCAGAA -3'
Posted On 2013-09-03