Mutagenetix > Incidental Mutation

Incidental Mutation 'R0731:Btaf1'

67598

Institutional Source

Beutler Lab

Gene Symbol

Btaf1

Ensembl Gene

ENSMUSG00000040565

Gene Name

B-TFIID TATA-box binding protein associated factor 1

Synonyms

E430027O22Rik

MMRRC Submission

038912-MU

Accession Numbers

Genbank: NM_001080706

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R0731 (G1)

Quality Score

101

Status

Validated

Chromosome

Chromosomal Location

36926079-37012752 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 36997495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099494]

AlphaFold

E9QAE3

Predicted Effect

probably null
Transcript: ENSMUST00000099494

SMART Domains

Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
low complexity region	143	152	N/A	INTRINSIC
PDB:3OC3\|B	276	414	3e-6	PDB
low complexity region	438	454	N/A	INTRINSIC
Pfam:DUF3535	585	1051	1.1e-133	PFAM
low complexity region	1099	1110	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
DEXDc	1261	1469	3.02e-30	SMART
low complexity region	1630	1641	N/A	INTRINSIC
HELICc	1657	1743	2.22e-19	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]

Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Kifc3	G	A	8: 95,105,733	T487I	probably damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Btaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Btaf1	APN	19	37009702	missense	probably damaging	1.00
IGL00535:Btaf1	APN	19	36997535	missense	probably damaging	1.00
IGL00574:Btaf1	APN	19	36969930	missense	probably benign	0.00
IGL00969:Btaf1	APN	19	37011252	splice site	probably benign
IGL01325:Btaf1	APN	19	37004649	splice site	probably benign
IGL01399:Btaf1	APN	19	37000170	nonsense	probably null
IGL02024:Btaf1	APN	19	36992426	splice site	probably benign
IGL02471:Btaf1	APN	19	37000192	missense	probably damaging	0.96
IGL02664:Btaf1	APN	19	36978428	splice site	probably benign
IGL02898:Btaf1	APN	19	36969068	missense	probably benign
IGL02995:Btaf1	APN	19	36981135	splice site	probably benign
IGL03023:Btaf1	APN	19	37010015	missense	possibly damaging	0.85
IGL03188:Btaf1	APN	19	36949108	missense	possibly damaging	0.91
IGL03353:Btaf1	APN	19	36992500	missense	probably damaging	1.00
freudenberg	UTSW	19	36988173	critical splice donor site	probably null
Galanos	UTSW	19	36949102	missense	probably damaging	1.00
3-1:Btaf1	UTSW	19	37010078	missense	probably damaging	1.00
R0013:Btaf1	UTSW	19	36958373	missense	probably benign
R0048:Btaf1	UTSW	19	37003524	missense	probably benign	0.01
R0117:Btaf1	UTSW	19	36969968	missense	probably benign	0.06
R0207:Btaf1	UTSW	19	37009648	nonsense	probably null
R0310:Btaf1	UTSW	19	37004534	missense	probably damaging	0.96
R0377:Btaf1	UTSW	19	36989002	missense	probably benign
R0419:Btaf1	UTSW	19	36945229	missense	probably damaging	0.99
R0440:Btaf1	UTSW	19	36986653	missense	probably damaging	0.99
R0532:Btaf1	UTSW	19	36951186	splice site	probably benign
R0612:Btaf1	UTSW	19	36969137	missense	probably damaging	0.99
R0780:Btaf1	UTSW	19	36988922	missense	probably damaging	0.99
R0919:Btaf1	UTSW	19	36990743	missense	probably benign	0.03
R1104:Btaf1	UTSW	19	37004602	missense	probably damaging	1.00
R1263:Btaf1	UTSW	19	36956524	missense	probably benign	0.10
R1325:Btaf1	UTSW	19	36969162	missense	possibly damaging	0.68
R1447:Btaf1	UTSW	19	36992454	missense	probably benign	0.00
R1554:Btaf1	UTSW	19	36996598	missense	probably benign	0.02
R1649:Btaf1	UTSW	19	36981722	missense	probably benign
R1715:Btaf1	UTSW	19	36969121	missense	probably damaging	0.99
R1733:Btaf1	UTSW	19	36994962	missense	probably benign
R1764:Btaf1	UTSW	19	36951118	missense	probably benign	0.12
R1874:Btaf1	UTSW	19	36980583	missense	probably benign
R1911:Btaf1	UTSW	19	36986630	missense	probably benign
R1933:Btaf1	UTSW	19	36972957	missense	probably damaging	1.00
R2080:Btaf1	UTSW	19	36951148	missense	probably benign	0.09
R2483:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R2510:Btaf1	UTSW	19	37002445	missense	probably benign	0.08
R3623:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3624:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3801:Btaf1	UTSW	19	36986548	missense	probably benign
R3801:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3802:Btaf1	UTSW	19	36986548	missense	probably benign
R3802:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3803:Btaf1	UTSW	19	36986548	missense	probably benign
R3803:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R4077:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4079:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4133:Btaf1	UTSW	19	36961738	missense	probably benign	0.00
R4673:Btaf1	UTSW	19	36978372	missense	probably benign	0.00
R4731:Btaf1	UTSW	19	36981078	missense	probably benign	0.03
R4796:Btaf1	UTSW	19	36956428	missense	possibly damaging	0.95
R4824:Btaf1	UTSW	19	36981048	missense	possibly damaging	0.84
R4835:Btaf1	UTSW	19	37002458	missense	probably benign	0.00
R4837:Btaf1	UTSW	19	36966785	missense	probably benign
R4925:Btaf1	UTSW	19	37011333	missense	probably benign
R4968:Btaf1	UTSW	19	36969951	missense	probably null	0.71
R4976:Btaf1	UTSW	19	36986579	missense	probably benign
R5001:Btaf1	UTSW	19	36986652	missense	possibly damaging	0.90
R5037:Btaf1	UTSW	19	37003531	missense	probably damaging	1.00
R5039:Btaf1	UTSW	19	36990762	missense	probably benign
R5211:Btaf1	UTSW	19	36996562	missense	probably benign	0.32
R5422:Btaf1	UTSW	19	36951107	missense	probably benign	0.09
R5429:Btaf1	UTSW	19	36994857	missense	possibly damaging	0.58
R5530:Btaf1	UTSW	19	36990775	missense	possibly damaging	0.85
R5582:Btaf1	UTSW	19	36988173	critical splice donor site	probably null
R5654:Btaf1	UTSW	19	36983615	missense	probably benign	0.35
R5744:Btaf1	UTSW	19	37004490	missense	probably benign	0.02
R6082:Btaf1	UTSW	19	36983542	missense	probably damaging	1.00
R6243:Btaf1	UTSW	19	36981120	missense	probably benign	0.02
R6291:Btaf1	UTSW	19	36973008	missense	probably benign	0.00
R6502:Btaf1	UTSW	19	36983617	missense	probably benign
R7034:Btaf1	UTSW	19	37004469	missense	probably benign
R7036:Btaf1	UTSW	19	37004469	missense	probably benign
R7085:Btaf1	UTSW	19	36972918	missense	probably benign
R7097:Btaf1	UTSW	19	36949102	missense	probably damaging	1.00
R7248:Btaf1	UTSW	19	36945314	missense	possibly damaging	0.54
R7386:Btaf1	UTSW	19	36958382	missense	probably benign	0.02
R7402:Btaf1	UTSW	19	37003515	missense	probably damaging	1.00
R7452:Btaf1	UTSW	19	36969127	missense	probably damaging	1.00
R7493:Btaf1	UTSW	19	37009605	missense	probably damaging	1.00
R7513:Btaf1	UTSW	19	36978403	missense	probably benign	0.30
R7888:Btaf1	UTSW	19	36965636	missense	probably benign	0.10
R7944:Btaf1	UTSW	19	36949165	missense	probably benign
R8062:Btaf1	UTSW	19	36992465	missense	probably benign	0.00
R8559:Btaf1	UTSW	19	36986873	missense	probably benign	0.00
R8793:Btaf1	UTSW	19	36981029	missense	probably benign	0.21
R8855:Btaf1	UTSW	19	36958501	missense	probably benign
R8866:Btaf1	UTSW	19	36958501	missense	probably benign
R9016:Btaf1	UTSW	19	36994305	missense	probably benign	0.00
R9028:Btaf1	UTSW	19	36969108	missense	probably damaging	1.00
R9109:Btaf1	UTSW	19	36986714	missense	probably benign
R9172:Btaf1	UTSW	19	37000230	missense	probably damaging	0.98
R9298:Btaf1	UTSW	19	36986714	missense	probably benign
R9717:Btaf1	UTSW	19	36945246	missense	probably benign	0.28
W0251:Btaf1	UTSW	19	37003504	missense	probably damaging	1.00
X0027:Btaf1	UTSW	19	36949096	nonsense	probably null
Z1088:Btaf1	UTSW	19	36986618	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTACCTTTggggctggtgagatg -3'
(R):5'- ACTAAATGCTATGCCACCTGGCAAG -3'

Sequencing Primer
(F):5'- gcacccgactgttcttcc -3'
(R):5'- CCTGGATTGGTGTTCCAGAA -3'

Posted On

2013-09-03