Incidental Mutation 'R8867:Gatb'
ID 675989
Institutional Source Beutler Lab
Gene Symbol Gatb
Ensembl Gene ENSMUSG00000028085
Gene Name glutamyl-tRNA(Gln) amidotransferase, subunit B
Synonyms Pet112, Pet112l, 9430026F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R8867 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 85574119-85655622 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85604409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 157 (L157H)
Ref Sequence ENSEMBL: ENSMUSP00000119949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107672] [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]
AlphaFold Q99JT1
Predicted Effect probably damaging
Transcript: ENSMUST00000107672
AA Change: L157H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103299
Gene: ENSMUSG00000028085
AA Change: L157H

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-103 PFAM
Pfam:GatB_Yqey 406 472 6.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107674
AA Change: L157H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: L157H

DomainStartEndE-ValueType
Pfam:GatB_N 64 354 6.7e-105 PFAM
GatB_Yqey 406 518 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127348
AA Change: L157H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085
AA Change: L157H

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-101 PFAM
GatB_Yqey 406 555 4.13e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 S253P probably damaging Het
Acbd5 T C 2: 23,080,358 M97T possibly damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ano1 A G 7: 144,669,660 S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 N732D probably benign Het
Apcs A T 1: 172,894,437 L114Q possibly damaging Het
Apmap T C 2: 150,589,966 probably benign Het
Asxl3 C A 18: 22,516,490 T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 T388A probably damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Cmbl C A 15: 31,581,927 H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 I262N probably damaging Het
Col6a3 C T 1: 90,787,951 R2260H unknown Het
Cracr2a T A 6: 127,629,773 L260* probably null Het
Csmd2 A G 4: 128,557,676 Y3409C Het
Cyp4b1 C T 4: 115,635,972 R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dnah6 A G 6: 73,021,148 L4097P probably damaging Het
Dpcr1 A T 17: 35,637,980 F242L probably benign Het
Dppa3 G A 6: 122,628,643 R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 R311H probably benign Het
Fhad1 T C 4: 141,929,574 R90G probably damaging Het
Fitm2 A T 2: 163,469,682 W204R possibly damaging Het
Gm34653 A G 2: 34,838,624 D145G probably damaging Het
Gm5111 G A 6: 48,589,695 probably null Het
Gm7298 A C 6: 121,771,829 I688L probably benign Het
Hecw1 T C 13: 14,247,690 probably null Het
Ift122 T A 6: 115,880,671 V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 I121F possibly damaging Het
Kif21a A G 15: 90,968,179 V902A probably damaging Het
Klhl38 T C 15: 58,315,039 M512V probably benign Het
Klk1b1 A C 7: 43,970,323 N102T probably damaging Het
Lama4 T A 10: 39,048,000 L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 D740V probably damaging Het
Mapk7 G T 11: 61,493,806 P25T probably benign Het
Mcm3ap C A 10: 76,470,704 A217D probably benign Het
Ncaph2 A G 15: 89,370,402 E406G probably benign Het
Ncor2 T C 5: 125,102,675 I69V unknown Het
Nfatc3 A G 8: 106,079,008 S170G probably damaging Het
Nptn G A 9: 58,618,981 R137Q probably damaging Het
Nsd1 A T 13: 55,282,757 K1581N probably damaging Het
Olfr1105 G T 2: 87,033,459 T254K probably damaging Het
Olfr224 A G 11: 58,566,736 L203P probably damaging Het
Olfr357 T C 2: 36,997,679 Y290H probably damaging Het
Olfr597 T A 7: 103,321,242 L277Q Het
Olfr630 G A 7: 103,754,686 Q300* probably null Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Park2 A G 17: 11,237,561 T91A probably benign Het
Pdcl T C 2: 37,352,336 E134G probably damaging Het
Pikfyve T A 1: 65,244,417 Y738N probably damaging Het
Pkd1 A G 17: 24,573,833 D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 probably benign Het
Rgs18 T A 1: 144,753,960 D187V probably damaging Het
Ripor2 C T 13: 24,638,777 probably benign Het
Rnf165 T C 18: 77,475,486 E159G possibly damaging Het
Rpl3l G A 17: 24,735,481 G172D probably damaging Het
Sdf4 A G 4: 156,009,302 T298A probably damaging Het
Slc17a3 T C 13: 23,855,960 V327A Het
Slc4a1ap T A 5: 31,550,715 F677L probably benign Het
Stoml2 A G 4: 43,028,256 V324A probably benign Het
Syne2 A G 12: 75,942,846 Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 N481D possibly damaging Het
Tert T C 13: 73,628,447 M439T probably benign Het
Thsd7a A T 6: 12,338,687 D1181E Het
Tln2 G A 9: 67,330,550 T33I probably damaging Het
Top3a A G 11: 60,742,655 S872P probably benign Het
Trim10 T C 17: 36,870,156 L93P probably benign Het
Trpc7 C T 13: 56,860,933 S307N probably benign Het
Ttc37 C T 13: 76,131,309 S620L probably damaging Het
Ttn A T 2: 76,810,083 V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp683 C T 4: 134,058,684 T374I probably damaging Het
Other mutations in Gatb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gatb APN 3 85601920 missense possibly damaging 0.95
IGL00963:Gatb APN 3 85618948 missense probably benign 0.00
IGL01363:Gatb APN 3 85652345 missense probably damaging 1.00
IGL01650:Gatb APN 3 85613484 missense possibly damaging 0.68
IGL01973:Gatb APN 3 85611424 missense probably damaging 1.00
IGL02195:Gatb APN 3 85604448 missense probably benign 0.00
IGL02670:Gatb APN 3 85613551 splice site probably null
IGL02992:Gatb APN 3 85618916 missense probably damaging 1.00
IGL03025:Gatb APN 3 85575874 missense probably damaging 0.99
IGL03035:Gatb APN 3 85601947 missense probably damaging 1.00
IGL03090:Gatb APN 3 85619023 intron probably benign
R1313:Gatb UTSW 3 85653826 missense probably benign 0.01
R1851:Gatb UTSW 3 85618877 missense probably damaging 0.99
R1852:Gatb UTSW 3 85618877 missense probably damaging 0.99
R2134:Gatb UTSW 3 85611370 missense probably damaging 1.00
R2209:Gatb UTSW 3 85653805 missense probably benign 0.03
R5189:Gatb UTSW 3 85636931 missense probably benign 0.00
R5218:Gatb UTSW 3 85604444 missense probably benign
R5857:Gatb UTSW 3 85575932 missense probably damaging 1.00
R5871:Gatb UTSW 3 85653776 nonsense probably null
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6430:Gatb UTSW 3 85637038 missense probably benign 0.01
R6661:Gatb UTSW 3 85652419 splice site probably null
R7184:Gatb UTSW 3 85636951 nonsense probably null
R7210:Gatb UTSW 3 85574220 missense probably benign
R7501:Gatb UTSW 3 85636990 missense probably damaging 0.99
R7919:Gatb UTSW 3 85604521 missense probably damaging 1.00
R8335:Gatb UTSW 3 85574321 critical splice donor site probably null
R8536:Gatb UTSW 3 85604561 missense probably damaging 0.99
R9312:Gatb UTSW 3 85653763 missense probably damaging 1.00
R9330:Gatb UTSW 3 85652494 missense probably benign 0.03
X0013:Gatb UTSW 3 85601861 missense probably damaging 1.00
Z1177:Gatb UTSW 3 85636973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTATTAGGGGCAAGAGACC -3'
(R):5'- GGCTCTGTTCAAATCAATGAGTG -3'

Sequencing Primer
(F):5'- CAGGTTAATTATGCCAGCAGTG -3'
(R):5'- AATCAATGAGTGTCTGTGACCTCAGG -3'
Posted On 2021-07-15