Incidental Mutation 'R8867:Cracr2a'
ID 676010
Institutional Source Beutler Lab
Gene Symbol Cracr2a
Ensembl Gene ENSMUSG00000061414
Gene Name calcium release activated channel regulator 2A
Synonyms LOC243645, Efcab4b, LOC381812
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8867 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 127561338-127674248 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 127629773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 260 (L260*)
Ref Sequence ENSEMBL: ENSMUSP00000071494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]
AlphaFold Q3UP38
Predicted Effect probably null
Transcript: ENSMUST00000071563
AA Change: L260*
SMART Domains Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: L260*

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212051
AA Change: L260*
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 S253P probably damaging Het
Acbd5 T C 2: 23,080,358 M97T possibly damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ano1 A G 7: 144,669,660 S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 N732D probably benign Het
Apcs A T 1: 172,894,437 L114Q possibly damaging Het
Apmap T C 2: 150,589,966 probably benign Het
Asxl3 C A 18: 22,516,490 T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 T388A probably damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Cmbl C A 15: 31,581,927 H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 I262N probably damaging Het
Col6a3 C T 1: 90,787,951 R2260H unknown Het
Csmd2 A G 4: 128,557,676 Y3409C Het
Cyp4b1 C T 4: 115,635,972 R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dnah6 A G 6: 73,021,148 L4097P probably damaging Het
Dpcr1 A T 17: 35,637,980 F242L probably benign Het
Dppa3 G A 6: 122,628,643 R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 R311H probably benign Het
Fhad1 T C 4: 141,929,574 R90G probably damaging Het
Fitm2 A T 2: 163,469,682 W204R possibly damaging Het
Gatb T A 3: 85,604,409 L157H probably damaging Het
Gm34653 A G 2: 34,838,624 D145G probably damaging Het
Gm5111 G A 6: 48,589,695 probably null Het
Gm7298 A C 6: 121,771,829 I688L probably benign Het
Hecw1 T C 13: 14,247,690 probably null Het
Ift122 T A 6: 115,880,671 V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 I121F possibly damaging Het
Kif21a A G 15: 90,968,179 V902A probably damaging Het
Klhl38 T C 15: 58,315,039 M512V probably benign Het
Klk1b1 A C 7: 43,970,323 N102T probably damaging Het
Lama4 T A 10: 39,048,000 L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 D740V probably damaging Het
Mapk7 G T 11: 61,493,806 P25T probably benign Het
Mcm3ap C A 10: 76,470,704 A217D probably benign Het
Ncaph2 A G 15: 89,370,402 E406G probably benign Het
Ncor2 T C 5: 125,102,675 I69V unknown Het
Nfatc3 A G 8: 106,079,008 S170G probably damaging Het
Nptn G A 9: 58,618,981 R137Q probably damaging Het
Nsd1 A T 13: 55,282,757 K1581N probably damaging Het
Olfr1105 G T 2: 87,033,459 T254K probably damaging Het
Olfr224 A G 11: 58,566,736 L203P probably damaging Het
Olfr357 T C 2: 36,997,679 Y290H probably damaging Het
Olfr597 T A 7: 103,321,242 L277Q Het
Olfr630 G A 7: 103,754,686 Q300* probably null Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Park2 A G 17: 11,237,561 T91A probably benign Het
Pdcl T C 2: 37,352,336 E134G probably damaging Het
Pikfyve T A 1: 65,244,417 Y738N probably damaging Het
Pkd1 A G 17: 24,573,833 D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 probably benign Het
Rgs18 T A 1: 144,753,960 D187V probably damaging Het
Ripor2 C T 13: 24,638,777 probably benign Het
Rnf165 T C 18: 77,475,486 E159G possibly damaging Het
Rpl3l G A 17: 24,735,481 G172D probably damaging Het
Sdf4 A G 4: 156,009,302 T298A probably damaging Het
Slc17a3 T C 13: 23,855,960 V327A Het
Slc4a1ap T A 5: 31,550,715 F677L probably benign Het
Stoml2 A G 4: 43,028,256 V324A probably benign Het
Syne2 A G 12: 75,942,846 Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 N481D possibly damaging Het
Tert T C 13: 73,628,447 M439T probably benign Het
Thsd7a A T 6: 12,338,687 D1181E Het
Tln2 G A 9: 67,330,550 T33I probably damaging Het
Top3a A G 11: 60,742,655 S872P probably benign Het
Trim10 T C 17: 36,870,156 L93P probably benign Het
Trpc7 C T 13: 56,860,933 S307N probably benign Het
Ttc37 C T 13: 76,131,309 S620L probably damaging Het
Ttn A T 2: 76,810,083 V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp683 C T 4: 134,058,684 T374I probably damaging Het
Other mutations in Cracr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Cracr2a APN 6 127629930 intron probably benign
PIT4812001:Cracr2a UTSW 6 127625870 missense probably damaging 1.00
R0111:Cracr2a UTSW 6 127604061 missense probably benign 0.00
R0180:Cracr2a UTSW 6 127604074 critical splice donor site probably null
R1612:Cracr2a UTSW 6 127603929 nonsense probably null
R1929:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2055:Cracr2a UTSW 6 127608601 nonsense probably null
R2270:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2272:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2915:Cracr2a UTSW 6 127611505 missense probably damaging 0.98
R4476:Cracr2a UTSW 6 127629819 missense probably benign 0.18
R4600:Cracr2a UTSW 6 127603888 missense probably benign 0.00
R4767:Cracr2a UTSW 6 127611507 missense probably damaging 0.98
R5256:Cracr2a UTSW 6 127604029 missense probably damaging 1.00
R5657:Cracr2a UTSW 6 127604007 missense probably damaging 1.00
R5729:Cracr2a UTSW 6 127607236 missense possibly damaging 0.88
R6437:Cracr2a UTSW 6 127631831 missense probably damaging 0.96
R6572:Cracr2a UTSW 6 127608752 splice site probably null
R6851:Cracr2a UTSW 6 127608716 missense probably damaging 1.00
R7177:Cracr2a UTSW 6 127608706 missense probably benign 0.00
R7616:Cracr2a UTSW 6 127608697 nonsense probably null
R7809:Cracr2a UTSW 6 127649962 missense probably benign
R8030:Cracr2a UTSW 6 127611423 missense probably damaging 0.96
R8084:Cracr2a UTSW 6 127639172 missense probably benign 0.26
R8731:Cracr2a UTSW 6 127625927 critical splice donor site probably null
Z1177:Cracr2a UTSW 6 127607244 missense probably benign 0.02
Z1177:Cracr2a UTSW 6 127669063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACATCTCAGAGCACTAATTTG -3'
(R):5'- ACAGGTCTTCTCAGGGCAAG -3'

Sequencing Primer
(F):5'- AAGTGGGTCACTGAATCCTG -3'
(R):5'- GGTCTTCTCAGGGCAAGTTAAAAATC -3'
Posted On 2021-07-15