Incidental Mutation 'R8867:Bcl2a1a'
ID 676020
Institutional Source Beutler Lab
Gene Symbol Bcl2a1a
Ensembl Gene ENSMUSG00000102037
Gene Name B cell leukemia/lymphoma 2 related protein A1a
Synonyms A1, Hbpa1, Bcl2a1, Bfl-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R8867 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 88956900-88962419 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88957450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 134 (I134L)
Ref Sequence ENSEMBL: ENSMUSP00000096086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098485]
AlphaFold Q07440
PDB Structure STRUCTURE OF MOUSE A1 BOUND TO THE PUMA BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BMF BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BAK BH3-DOMAIN [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE A1 BOUND TO THE BID BH3-DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000098485
AA Change: I134L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096086
Gene: ENSMUSG00000102037
AA Change: I134L

DomainStartEndE-ValueType
BCL 37 140 2.45e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Homozygous null mutants show enhanced spontaneous apoptosis of neutrophils, while both heterozygous and homozygous null mutants lack LPS-induced neutrophil apoptosis inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 S253P probably damaging Het
Acbd5 T C 2: 23,080,358 M97T possibly damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ano1 A G 7: 144,669,660 S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 N732D probably benign Het
Apcs A T 1: 172,894,437 L114Q possibly damaging Het
Apmap T C 2: 150,589,966 probably benign Het
Asxl3 C A 18: 22,516,490 T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 T388A probably damaging Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Cmbl C A 15: 31,581,927 H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 I262N probably damaging Het
Col6a3 C T 1: 90,787,951 R2260H unknown Het
Cracr2a T A 6: 127,629,773 L260* probably null Het
Csmd2 A G 4: 128,557,676 Y3409C Het
Cyp4b1 C T 4: 115,635,972 R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dnah6 A G 6: 73,021,148 L4097P probably damaging Het
Dpcr1 A T 17: 35,637,980 F242L probably benign Het
Dppa3 G A 6: 122,628,643 R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 R311H probably benign Het
Fhad1 T C 4: 141,929,574 R90G probably damaging Het
Fitm2 A T 2: 163,469,682 W204R possibly damaging Het
Gatb T A 3: 85,604,409 L157H probably damaging Het
Gm34653 A G 2: 34,838,624 D145G probably damaging Het
Gm5111 G A 6: 48,589,695 probably null Het
Gm7298 A C 6: 121,771,829 I688L probably benign Het
Hecw1 T C 13: 14,247,690 probably null Het
Ift122 T A 6: 115,880,671 V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 I121F possibly damaging Het
Kif21a A G 15: 90,968,179 V902A probably damaging Het
Klhl38 T C 15: 58,315,039 M512V probably benign Het
Klk1b1 A C 7: 43,970,323 N102T probably damaging Het
Lama4 T A 10: 39,048,000 L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 D740V probably damaging Het
Mapk7 G T 11: 61,493,806 P25T probably benign Het
Mcm3ap C A 10: 76,470,704 A217D probably benign Het
Ncaph2 A G 15: 89,370,402 E406G probably benign Het
Ncor2 T C 5: 125,102,675 I69V unknown Het
Nfatc3 A G 8: 106,079,008 S170G probably damaging Het
Nptn G A 9: 58,618,981 R137Q probably damaging Het
Nsd1 A T 13: 55,282,757 K1581N probably damaging Het
Olfr1105 G T 2: 87,033,459 T254K probably damaging Het
Olfr224 A G 11: 58,566,736 L203P probably damaging Het
Olfr357 T C 2: 36,997,679 Y290H probably damaging Het
Olfr597 T A 7: 103,321,242 L277Q Het
Olfr630 G A 7: 103,754,686 Q300* probably null Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Park2 A G 17: 11,237,561 T91A probably benign Het
Pdcl T C 2: 37,352,336 E134G probably damaging Het
Pikfyve T A 1: 65,244,417 Y738N probably damaging Het
Pkd1 A G 17: 24,573,833 D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 probably benign Het
Rgs18 T A 1: 144,753,960 D187V probably damaging Het
Ripor2 C T 13: 24,638,777 probably benign Het
Rnf165 T C 18: 77,475,486 E159G possibly damaging Het
Rpl3l G A 17: 24,735,481 G172D probably damaging Het
Sdf4 A G 4: 156,009,302 T298A probably damaging Het
Slc17a3 T C 13: 23,855,960 V327A Het
Slc4a1ap T A 5: 31,550,715 F677L probably benign Het
Stoml2 A G 4: 43,028,256 V324A probably benign Het
Syne2 A G 12: 75,942,846 Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 N481D possibly damaging Het
Tert T C 13: 73,628,447 M439T probably benign Het
Thsd7a A T 6: 12,338,687 D1181E Het
Tln2 G A 9: 67,330,550 T33I probably damaging Het
Top3a A G 11: 60,742,655 S872P probably benign Het
Trim10 T C 17: 36,870,156 L93P probably benign Het
Trpc7 C T 13: 56,860,933 S307N probably benign Het
Ttc37 C T 13: 76,131,309 S620L probably damaging Het
Ttn A T 2: 76,810,083 V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp683 C T 4: 134,058,684 T374I probably damaging Het
Other mutations in Bcl2a1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Bcl2a1a APN 9 88957447 missense probably damaging 1.00
IGL02942:Bcl2a1a APN 9 88957042 utr 5 prime probably benign
R0064:Bcl2a1a UTSW 9 88957463 missense probably damaging 1.00
R1672:Bcl2a1a UTSW 9 88957450 missense probably damaging 1.00
R2511:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4616:Bcl2a1a UTSW 9 88957453 missense probably damaging 1.00
R4618:Bcl2a1a UTSW 9 88957304 missense probably damaging 1.00
R4947:Bcl2a1a UTSW 9 88957282 missense probably damaging 1.00
R7584:Bcl2a1a UTSW 9 88957292 missense probably damaging 1.00
R8900:Bcl2a1a UTSW 9 88957258 missense probably benign 0.17
R9685:Bcl2a1a UTSW 9 88957132 missense probably benign 0.00
Z1177:Bcl2a1a UTSW 9 88957466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCACGTGGAATCCATAGATAC -3'
(R):5'- CCATTGGAAATGACCCAGGG -3'

Sequencing Primer
(F):5'- GGAATCCATAGATACCGCCAG -3'
(R):5'- GAAATGACCCAGGGGATTTTTG -3'
Posted On 2021-07-15