Incidental Mutation 'R8867:Nsd1'
ID676035
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8867 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55282757 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1581 (K1581N)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect probably damaging
Transcript: ENSMUST00000099490
AA Change: K1581N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: K1581N

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224973
AA Change: K1478N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 S253P probably damaging Het
Acbd5 T C 2: 23,080,358 M97T possibly damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ano1 A G 7: 144,669,660 S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 N732D probably benign Het
Apcs A T 1: 172,894,437 L114Q possibly damaging Het
Asxl3 C A 18: 22,516,490 T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 T388A probably damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Cmbl C A 15: 31,581,927 H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 I262N probably damaging Het
Col6a3 C T 1: 90,787,951 R2260H unknown Het
Cracr2a T A 6: 127,629,773 L260* probably null Het
Csmd2 A G 4: 128,557,676 Y3409C Het
Cyp4b1 C T 4: 115,635,972 R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dnah6 A G 6: 73,021,148 L4097P probably damaging Het
Dpcr1 A T 17: 35,637,980 F242L probably benign Het
Dppa3 G A 6: 122,628,643 R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 R311H probably benign Het
Fhad1 T C 4: 141,929,574 R90G probably damaging Het
Fitm2 A T 2: 163,469,682 W204R possibly damaging Het
Gatb T A 3: 85,604,409 L157H probably damaging Het
Gm34653 A G 2: 34,838,624 D145G probably damaging Het
Gm5111 G A 6: 48,589,695 probably null Het
Gm7298 A C 6: 121,771,829 I688L probably benign Het
Hecw1 T C 13: 14,247,690 probably null Het
Ift122 T A 6: 115,880,671 V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 I121F possibly damaging Het
Kif21a A G 15: 90,968,179 V902A probably damaging Het
Klhl38 T C 15: 58,315,039 M512V probably benign Het
Klk1b1 A C 7: 43,970,323 N102T probably damaging Het
Lama4 T A 10: 39,048,000 L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 D740V probably damaging Het
Mapk7 G T 11: 61,493,806 P25T probably benign Het
Mcm3ap C A 10: 76,470,704 A217D probably benign Het
Ncaph2 A G 15: 89,370,402 E406G probably benign Het
Ncor2 T C 5: 125,102,675 I69V unknown Het
Nfatc3 A G 8: 106,079,008 S170G probably damaging Het
Nptn G A 9: 58,618,981 R137Q probably damaging Het
Olfr1105 G T 2: 87,033,459 T254K probably damaging Het
Olfr224 A G 11: 58,566,736 L203P probably damaging Het
Olfr357 T C 2: 36,997,679 Y290H probably damaging Het
Olfr597 T A 7: 103,321,242 L277Q Het
Olfr630 G A 7: 103,754,686 Q300* probably null Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Park2 A G 17: 11,237,561 T91A probably benign Het
Pdcl T C 2: 37,352,336 E134G probably damaging Het
Pikfyve T A 1: 65,244,417 Y738N probably damaging Het
Pkd1 A G 17: 24,573,833 D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 probably benign Het
Rgs18 T A 1: 144,753,960 D187V probably damaging Het
Ripor2 C T 13: 24,638,777 probably benign Het
Rnf165 T C 18: 77,475,486 E159G possibly damaging Het
Rpl3l G A 17: 24,735,481 G172D probably damaging Het
Sdf4 A G 4: 156,009,302 T298A probably damaging Het
Slc17a3 T C 13: 23,855,960 V327A Het
Slc4a1ap T A 5: 31,550,715 F677L probably benign Het
Stoml2 A G 4: 43,028,256 V324A probably benign Het
Syne2 A G 12: 75,942,846 Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 N481D possibly damaging Het
Tert T C 13: 73,628,447 M439T probably benign Het
Thsd7a A T 6: 12,338,687 D1181E Het
Tln2 G A 9: 67,330,550 T33I probably damaging Het
Top3a A G 11: 60,742,655 S872P probably benign Het
Trim10 T C 17: 36,870,156 L93P probably benign Het
Trpc7 C T 13: 56,860,933 S307N probably benign Het
Ttc37 C T 13: 76,131,309 S620L probably damaging Het
Ttn A T 2: 76,810,083 V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp683 C T 4: 134,058,684 T374I probably damaging Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
scribe UTSW 13 55291236 missense probably damaging 1.00
stenographer UTSW 13 55298376 splice site probably null
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55213374 missense probably benign
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55277639 missense probably damaging 1.00
R7884:Nsd1 UTSW 13 55313255 missense probably damaging 0.99
R8032:Nsd1 UTSW 13 55310383 missense probably damaging 1.00
R8113:Nsd1 UTSW 13 55245621 missense probably benign
R8152:Nsd1 UTSW 13 55310367 missense possibly damaging 0.49
R8183:Nsd1 UTSW 13 55312373 missense probably damaging 1.00
R8432:Nsd1 UTSW 13 55247703 missense possibly damaging 0.91
R8462:Nsd1 UTSW 13 55298376 splice site probably null
R8469:Nsd1 UTSW 13 55277553 missense possibly damaging 0.76
R8756:Nsd1 UTSW 13 55313693 missense probably benign 0.00
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Z1176:Nsd1 UTSW 13 55245525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAGGACTCTTCATTTGGG -3'
(R):5'- GTTATTGCCTTATCACTGATCACAC -3'

Sequencing Primer
(F):5'- CAGGACTCTTCATTTGGGAATTTTC -3'
(R):5'- TTAGTCAAGTAACATTTTCTGAGGG -3'
Posted On2021-07-15