Incidental Mutation 'R8867:Park2'
ID 676045
Institutional Source Beutler Lab
Gene Symbol Park2
Ensembl Gene ENSMUSG00000023826
Gene Name Parkinson disease (autosomal recessive, juvenile) 2, parkin
Synonyms PRKN
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R8867 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 10840384-12063361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11237561 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000140587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168593] [ENSMUST00000191124] [ENSMUST00000218435]
AlphaFold Q9WVS6
PDB Structure NMR structure of ubiquitin-like domain in murine Parkin [SOLUTION NMR]
Crystal structure of ubiquitin-like domain of murine Parkin [X-RAY DIFFRACTION]
Crystal Structure of parkin ubiquitin-like domain R33Q mutant [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000168593
AA Change: T90A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127455
Gene: ENSMUSG00000023826
AA Change: T90A

DomainStartEndE-ValueType
UBQ 2 71 1.31e-13 SMART
Blast:UBQ 202 229 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191124
AA Change: T91A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826
AA Change: T91A

DomainStartEndE-ValueType
UBQ 1 72 3.58e-15 SMART
Blast:UBQ 203 230 2e-6 BLAST
Blast:RING 237 295 7e-11 BLAST
IBR 312 376 1.2e-14 SMART
IBR 400 456 5.16e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218435
AA Change: T90A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik G A 4: 73,942,850 S171F probably damaging Het
A130010J15Rik T C 1: 193,175,098 S253P probably damaging Het
Acbd5 T C 2: 23,080,358 M97T possibly damaging Het
Aire T C 10: 78,037,975 E300G probably damaging Het
Ano1 A G 7: 144,669,660 S99P possibly damaging Het
Ap5z1 A G 5: 142,477,256 N732D probably benign Het
Apcs A T 1: 172,894,437 L114Q possibly damaging Het
Apmap T C 2: 150,589,966 probably benign Het
Asxl3 C A 18: 22,516,490 T512N possibly damaging Het
Atp1a4 T C 1: 172,244,924 T388A probably damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Chd6 G A 2: 161,021,069 A444V probably benign Het
Cmbl C A 15: 31,581,927 H23Q probably benign Het
Cnnm2 T A 19: 46,762,557 I262N probably damaging Het
Col6a3 C T 1: 90,787,951 R2260H unknown Het
Cracr2a T A 6: 127,629,773 L260* probably null Het
Csmd2 A G 4: 128,557,676 Y3409C Het
Cyp4b1 C T 4: 115,635,972 R225H possibly damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dnah6 A G 6: 73,021,148 L4097P probably damaging Het
Dpcr1 A T 17: 35,637,980 F242L probably benign Het
Dppa3 G A 6: 122,628,643 R52Q probably benign Het
Fbxo31 C T 8: 121,555,228 R311H probably benign Het
Fhad1 T C 4: 141,929,574 R90G probably damaging Het
Fitm2 A T 2: 163,469,682 W204R possibly damaging Het
Gatb T A 3: 85,604,409 L157H probably damaging Het
Gm34653 A G 2: 34,838,624 D145G probably damaging Het
Gm5111 G A 6: 48,589,695 probably null Het
Gm7298 A C 6: 121,771,829 I688L probably benign Het
Hecw1 T C 13: 14,247,690 probably null Het
Ift122 T A 6: 115,880,671 V126E probably damaging Het
Iqcf6 A T 9: 106,627,499 I121F possibly damaging Het
Kif21a A G 15: 90,968,179 V902A probably damaging Het
Klhl38 T C 15: 58,315,039 M512V probably benign Het
Klk1b1 A C 7: 43,970,323 N102T probably damaging Het
Lama4 T A 10: 39,048,000 L468Q probably damaging Het
Lilra5 A T 7: 4,238,166 Q34L possibly damaging Het
Lrrc7 T A 3: 158,161,884 D740V probably damaging Het
Mapk7 G T 11: 61,493,806 P25T probably benign Het
Mcm3ap C A 10: 76,470,704 A217D probably benign Het
Ncaph2 A G 15: 89,370,402 E406G probably benign Het
Ncor2 T C 5: 125,102,675 I69V unknown Het
Nfatc3 A G 8: 106,079,008 S170G probably damaging Het
Nptn G A 9: 58,618,981 R137Q probably damaging Het
Nsd1 A T 13: 55,282,757 K1581N probably damaging Het
Olfr1105 G T 2: 87,033,459 T254K probably damaging Het
Olfr224 A G 11: 58,566,736 L203P probably damaging Het
Olfr357 T C 2: 36,997,679 Y290H probably damaging Het
Olfr597 T A 7: 103,321,242 L277Q Het
Olfr630 G A 7: 103,754,686 Q300* probably null Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Pdcl T C 2: 37,352,336 E134G probably damaging Het
Pikfyve T A 1: 65,244,417 Y738N probably damaging Het
Pkd1 A G 17: 24,573,833 D1498G probably damaging Het
Plxna1 T C 6: 89,333,097 N1029D probably benign Het
Ppp3cb C A 14: 20,546,449 probably benign Het
Rgs18 T A 1: 144,753,960 D187V probably damaging Het
Ripor2 C T 13: 24,638,777 probably benign Het
Rnf165 T C 18: 77,475,486 E159G possibly damaging Het
Rpl3l G A 17: 24,735,481 G172D probably damaging Het
Sdf4 A G 4: 156,009,302 T298A probably damaging Het
Slc17a3 T C 13: 23,855,960 V327A Het
Slc4a1ap T A 5: 31,550,715 F677L probably benign Het
Stoml2 A G 4: 43,028,256 V324A probably benign Het
Syne2 A G 12: 75,942,846 Q1833R probably damaging Het
Syt6 A G 3: 103,627,055 N481D possibly damaging Het
Tert T C 13: 73,628,447 M439T probably benign Het
Thsd7a A T 6: 12,338,687 D1181E Het
Tln2 G A 9: 67,330,550 T33I probably damaging Het
Top3a A G 11: 60,742,655 S872P probably benign Het
Trim10 T C 17: 36,870,156 L93P probably benign Het
Trpc7 C T 13: 56,860,933 S307N probably benign Het
Ttc37 C T 13: 76,131,309 S620L probably damaging Het
Ttn A T 2: 76,810,083 V13727E probably damaging Het
Vmn1r220 T C 13: 23,184,101 S142G probably benign Het
Vmn1r32 A G 6: 66,553,667 S42P probably damaging Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp683 C T 4: 134,058,684 T374I probably damaging Het
Other mutations in Park2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4340:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4342:Park2 UTSW 17 11854763 missense probably damaging 1.00
PIT4651001:Park2 UTSW 17 11067243 missense probably damaging 1.00
R0333:Park2 UTSW 17 11067140 missense probably damaging 1.00
R0543:Park2 UTSW 17 11067179 missense probably damaging 1.00
R4460:Park2 UTSW 17 12061646 missense probably damaging 1.00
R4710:Park2 UTSW 17 11854833 missense possibly damaging 0.89
R4742:Park2 UTSW 17 11237704 critical splice donor site probably null
R4752:Park2 UTSW 17 12004123 missense probably benign
R4911:Park2 UTSW 17 10840472 utr 5 prime probably benign
R5653:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5654:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5655:Park2 UTSW 17 11237649 missense probably damaging 1.00
R6360:Park2 UTSW 17 12004052 missense probably damaging 1.00
R6698:Park2 UTSW 17 11067296 splice site probably null
R7163:Park2 UTSW 17 12061547 missense probably damaging 1.00
R7241:Park2 UTSW 17 11854861 missense possibly damaging 0.63
R7475:Park2 UTSW 17 11434614 missense probably benign
R7630:Park2 UTSW 17 11237568 missense probably benign
R8278:Park2 UTSW 17 12050722 missense probably benign 0.26
R8299:Park2 UTSW 17 11237521 missense probably benign 0.25
R8551:Park2 UTSW 17 11067216 missense probably damaging 0.99
R8558:Park2 UTSW 17 11237585 missense probably benign
R8706:Park2 UTSW 17 11237585 missense probably benign
R9241:Park2 UTSW 17 11237495 missense probably benign 0.10
R9272:Park2 UTSW 17 11237640 missense probably damaging 1.00
R9450:Park2 UTSW 17 11838634 missense possibly damaging 0.95
X0010:Park2 UTSW 17 11237576 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTCAATGCCACTGTTTCTGG -3'
(R):5'- ACAAACATGTTCAGTAGCCTTAAGC -3'

Sequencing Primer
(F):5'- CCACTGTTTCTGGTAGCAATTGAAC -3'
(R):5'- GCAGAATTACAGCAGTTACCTG -3'
Posted On 2021-07-15