Incidental Mutation 'R8868:Entpd2'
ID676058
Institutional Source Beutler Lab
Gene Symbol Entpd2
Ensembl Gene ENSMUSG00000015085
Gene Nameectonucleoside triphosphate diphosphohydrolase 2
SynonymsCd39l1, NTPDase2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8868 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25395874-25401321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25399713 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 376 (T376A)
Ref Sequence ENSEMBL: ENSMUSP00000028328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028328] [ENSMUST00000055921] [ENSMUST00000071442] [ENSMUST00000141567] [ENSMUST00000154809]
Predicted Effect probably benign
Transcript: ENSMUST00000028328
AA Change: T376A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028328
Gene: ENSMUSG00000015085
AA Change: T376A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:GDA1_CD39 32 459 9.7e-104 PFAM
low complexity region 465 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055921
SMART Domains Protein: ENSMUSP00000049602
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 341 9.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071442
SMART Domains Protein: ENSMUSP00000071387
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 332 7.2e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141567
SMART Domains Protein: ENSMUSP00000116275
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 231 7.8e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154809
SMART Domains Protein: ENSMUSP00000123386
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 142 1.8e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display smaller circumvallate papilla size and reduced neural responses to taste stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 T A 9: 26,979,248 N255Y probably damaging Het
Accsl A C 2: 93,866,145 L36R probably benign Het
Acvr2a T A 2: 48,873,457 V171E probably benign Het
Adgrl3 A G 5: 81,646,604 I491V probably benign Het
Ak9 G A 10: 41,317,846 probably null Het
Ak9 G T 10: 41,382,873 E789* probably null Het
Akr1c19 T A 13: 4,243,071 N275K probably benign Het
Alg1 A G 16: 5,243,693 H398R probably benign Het
Apol11a T A 15: 77,517,009 I232N probably damaging Het
Cacnb2 A G 2: 14,984,269 I437V probably benign Het
Catsper4 A G 4: 134,227,106 probably null Het
Crnn T C 3: 93,148,302 C132R probably benign Het
Cyp4a14 T A 4: 115,491,356 H337L probably damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dclre1b T C 3: 103,803,338 N419S probably benign Het
Dip2c A G 13: 9,575,467 D621G possibly damaging Het
Dmwd T A 7: 19,080,769 L448Q probably damaging Het
Dnajc13 G A 9: 104,165,788 H1922Y probably benign Het
E2f3 A T 13: 29,911,318 I329N probably damaging Het
Eml2 G A 7: 19,194,063 V266M probably benign Het
Flnb A G 14: 7,908,671 T1350A probably benign Het
Fmnl2 A G 2: 53,126,065 E999G unknown Het
Gm28710 G A 5: 16,823,154 G449D probably benign Het
Hivep1 A G 13: 42,158,931 Q1549R possibly damaging Het
Hps6 G A 19: 46,004,007 V128M possibly damaging Het
Ifi27 T C 12: 103,436,640 S66P possibly damaging Het
Ikbip T C 10: 91,096,325 V277A possibly damaging Het
Ints8 T C 4: 11,230,488 E451G probably benign Het
Itih2 A T 2: 10,127,789 S64T probably benign Het
Kcnc4 T A 3: 107,448,136 E332V probably damaging Het
Lrpprc C A 17: 84,771,492 G265C probably damaging Het
Nav1 G T 1: 135,585,205 A39E probably benign Het
Ogfod1 G T 8: 94,047,278 D103Y probably damaging Het
Olfr835 T G 9: 19,035,482 Y120D probably damaging Het
Olfr922 G A 9: 38,815,989 C162Y probably damaging Het
Olfr970 A G 9: 39,819,956 T106A probably benign Het
Ppp1r3a A T 6: 14,755,015 S78T probably damaging Het
Rnf148 A T 6: 23,654,541 V152E probably damaging Het
Sdf2 A T 11: 78,246,144 H50L probably damaging Het
Sec1 T A 7: 45,679,276 M116L probably benign Het
Sema6d T C 2: 124,654,194 S53P probably damaging Het
Siae A G 9: 37,616,836 Y35C probably damaging Het
Slc18b1 A T 10: 23,810,853 Y189F probably damaging Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Strn4 G A 7: 16,826,645 E241K probably benign Het
Svep1 A G 4: 58,135,578 I510T possibly damaging Het
Svop T C 5: 114,032,793 D395G probably damaging Het
Tbc1d14 A C 5: 36,571,544 S159R probably damaging Het
Tex50 T A 1: 161,157,278 I131F possibly damaging Het
Tssk1 A G 16: 17,895,020 K223R probably benign Het
Ttc3 A G 16: 94,451,143 I1565V probably benign Het
Ttn A T 2: 76,711,594 F33683I possibly damaging Het
Ttn T C 2: 76,953,126 M887V unknown Het
Usp45 G A 4: 21,815,399 probably null Het
Xirp1 A G 9: 120,017,805 S671P probably benign Het
Zbtb18 A G 1: 177,447,116 D5G probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp260 T G 7: 30,105,489 Y271* probably null Het
Zfp369 T A 13: 65,297,268 S742T possibly damaging Het
Zfp786 A T 6: 47,825,081 D87E probably damaging Het
Other mutations in Entpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Entpd2 APN 2 25398734 missense probably benign
IGL02869:Entpd2 APN 2 25398108 missense probably damaging 1.00
IGL03170:Entpd2 APN 2 25399481 missense probably damaging 1.00
R1280:Entpd2 UTSW 2 25399484 missense probably damaging 1.00
R2258:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2260:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2420:Entpd2 UTSW 2 25399283 missense probably benign
R2566:Entpd2 UTSW 2 25399283 missense probably benign 0.16
R4802:Entpd2 UTSW 2 25399764 splice site probably null
R4938:Entpd2 UTSW 2 25399417 missense probably benign 0.25
R5239:Entpd2 UTSW 2 25400818 missense probably damaging 0.96
R5374:Entpd2 UTSW 2 25399726 missense probably damaging 1.00
R5739:Entpd2 UTSW 2 25399492 missense possibly damaging 0.90
R5752:Entpd2 UTSW 2 25399769 unclassified probably benign
R5881:Entpd2 UTSW 2 25400812 missense probably damaging 1.00
R6016:Entpd2 UTSW 2 25398556 missense probably damaging 0.99
R6120:Entpd2 UTSW 2 25399466 missense probably benign 0.03
R6370:Entpd2 UTSW 2 25397417 missense probably damaging 1.00
R7301:Entpd2 UTSW 2 25400909 missense possibly damaging 0.88
R8059:Entpd2 UTSW 2 25398084 missense probably damaging 0.98
R8257:Entpd2 UTSW 2 25398121 missense probably damaging 1.00
RF007:Entpd2 UTSW 2 25400895 frame shift probably null
RF017:Entpd2 UTSW 2 25400895 frame shift probably null
RF018:Entpd2 UTSW 2 25400895 frame shift probably null
RF023:Entpd2 UTSW 2 25400895 frame shift probably null
RF024:Entpd2 UTSW 2 25400895 frame shift probably null
X0009:Entpd2 UTSW 2 25398679 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGGGGTTTTCCAGCCTC -3'
(R):5'- TGAGGAGACCACTGAAGATTTAGC -3'

Sequencing Primer
(F):5'- CTGGGAACTTCATAGTGAGTCC -3'
(R):5'- GACCACTGAAGATTTAGCTTACTCAG -3'
Posted On2021-07-15