Incidental Mutation 'R8868:Olfr835'
ID 676087
Institutional Source Beutler Lab
Gene Symbol Olfr835
Ensembl Gene ENSMUSG00000045204
Gene Name olfactory receptor 835
Synonyms MOR150-3, GA_x6K02T2PVTD-12771995-12772930
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock # R8868 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19032735-19037670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 19035482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 120 (Y120D)
Ref Sequence ENSEMBL: ENSMUSP00000148416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059315] [ENSMUST00000213018]
AlphaFold Q7TRG7
Predicted Effect probably damaging
Transcript: ENSMUST00000059315
AA Change: Y120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052610
Gene: ENSMUSG00000045204
AA Change: Y120D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 206 2.9e-7 PFAM
Pfam:7tm_1 41 303 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213018
AA Change: Y120D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 T A 9: 26,979,248 N255Y probably damaging Het
Accsl A C 2: 93,866,145 L36R probably benign Het
Acvr2a T A 2: 48,873,457 V171E probably benign Het
Adgrl3 A G 5: 81,646,604 I491V probably benign Het
Ak9 G A 10: 41,317,846 probably null Het
Ak9 G T 10: 41,382,873 E789* probably null Het
Akr1c19 T A 13: 4,243,071 N275K probably benign Het
Alg1 A G 16: 5,243,693 H398R probably benign Het
Apol11a T A 15: 77,517,009 I232N probably damaging Het
Cacnb2 A G 2: 14,984,269 I437V probably benign Het
Catsper4 A G 4: 134,227,106 probably null Het
Crnn T C 3: 93,148,302 C132R probably benign Het
Cyp4a14 T A 4: 115,491,356 H337L probably damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dclre1b T C 3: 103,803,338 N419S probably benign Het
Dip2c A G 13: 9,575,467 D621G possibly damaging Het
Dmwd T A 7: 19,080,769 L448Q probably damaging Het
Dnajc13 G A 9: 104,165,788 H1922Y probably benign Het
E2f3 A T 13: 29,911,318 I329N probably damaging Het
Eml2 G A 7: 19,194,063 V266M probably benign Het
Entpd2 A G 2: 25,399,713 T376A probably benign Het
Flnb A G 14: 7,908,671 T1350A probably benign Het
Fmnl2 A G 2: 53,126,065 E999G unknown Het
Gm28710 G A 5: 16,823,154 G449D probably benign Het
Hivep1 A G 13: 42,158,931 Q1549R possibly damaging Het
Hps6 G A 19: 46,004,007 V128M possibly damaging Het
Ifi27 T C 12: 103,436,640 S66P possibly damaging Het
Ikbip T C 10: 91,096,325 V277A possibly damaging Het
Ints8 T C 4: 11,230,488 E451G probably benign Het
Itih2 A T 2: 10,127,789 S64T probably benign Het
Kcnc4 T A 3: 107,448,136 E332V probably damaging Het
Krt23 T C 11: 99,483,741 probably benign Het
Lrpprc C A 17: 84,771,492 G265C probably damaging Het
Nav1 G T 1: 135,585,205 A39E probably benign Het
Ogfod1 G T 8: 94,047,278 D103Y probably damaging Het
Olfr922 G A 9: 38,815,989 C162Y probably damaging Het
Olfr970 A G 9: 39,819,956 T106A probably benign Het
Ppp1r3a A T 6: 14,755,015 S78T probably damaging Het
Rnf148 A T 6: 23,654,541 V152E probably damaging Het
Sdf2 A T 11: 78,246,144 H50L probably damaging Het
Sec1 T A 7: 45,679,276 M116L probably benign Het
Sema6d T C 2: 124,654,194 S53P probably damaging Het
Siae A G 9: 37,616,836 Y35C probably damaging Het
Slc18b1 A T 10: 23,810,853 Y189F probably damaging Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Strn4 G A 7: 16,826,645 E241K probably benign Het
Svep1 A G 4: 58,135,578 I510T possibly damaging Het
Svop T C 5: 114,032,793 D395G probably damaging Het
Tbc1d14 A C 5: 36,571,544 S159R probably damaging Het
Tex50 T A 1: 161,157,278 I131F possibly damaging Het
Tssk1 A G 16: 17,895,020 K223R probably benign Het
Ttc3 A G 16: 94,451,143 I1565V probably benign Het
Ttn A T 2: 76,711,594 F33683I possibly damaging Het
Ttn T C 2: 76,953,126 M887V unknown Het
Usp45 G A 4: 21,815,399 probably null Het
Wdr47 C T 3: 108,591,525 probably benign Het
Xirp1 A G 9: 120,017,805 S671P probably benign Het
Zbtb18 A G 1: 177,447,116 D5G probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp260 T G 7: 30,105,489 Y271* probably null Het
Zfp369 T A 13: 65,297,268 S742T possibly damaging Het
Zfp786 A T 6: 47,825,081 D87E probably damaging Het
Other mutations in Olfr835
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Olfr835 APN 9 19035288 nonsense probably null
IGL02546:Olfr835 APN 9 19035354 missense possibly damaging 0.88
R0010:Olfr835 UTSW 9 19035322 missense probably damaging 1.00
R0107:Olfr835 UTSW 9 19035333 missense probably damaging 1.00
R1867:Olfr835 UTSW 9 19035266 missense probably benign 0.36
R1891:Olfr835 UTSW 9 19035978 missense probably damaging 0.99
R1941:Olfr835 UTSW 9 19035866 missense possibly damaging 0.93
R4152:Olfr835 UTSW 9 19035520 nonsense probably null
R5451:Olfr835 UTSW 9 19035491 missense probably damaging 1.00
R5677:Olfr835 UTSW 9 19035558 missense possibly damaging 0.93
R5970:Olfr835 UTSW 9 19035147 missense probably benign
R6187:Olfr835 UTSW 9 19035393 missense probably benign 0.12
R6805:Olfr835 UTSW 9 19035301 missense probably damaging 1.00
R7183:Olfr835 UTSW 9 19035332 missense probably damaging 1.00
R8029:Olfr835 UTSW 9 19035794 missense probably damaging 1.00
R8139:Olfr835 UTSW 9 19035575 missense probably benign 0.07
R8736:Olfr835 UTSW 9 19035478 missense probably damaging 1.00
R8909:Olfr835 UTSW 9 19035592 missense probably benign 0.08
R9116:Olfr835 UTSW 9 19035477 missense probably damaging 1.00
R9479:Olfr835 UTSW 9 19035434 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTCATTTGCAAACACCCATG -3'
(R):5'- TCATGACCTGAGAAAGTTCACAG -3'

Sequencing Primer
(F):5'- ACACAGGATCAGAGCATC -3'
(R):5'- TTCACAGAAGAATAAGGGGATCTC -3'
Posted On 2021-07-15