Incidental Mutation 'R8868:Siae'
ID676089
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8868 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37616836 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 35 (Y35C)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]
Predicted Effect probably benign
Transcript: ENSMUST00000002007
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002013
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
Predicted Effect probably benign
Transcript: ENSMUST00000214786
Predicted Effect probably damaging
Transcript: ENSMUST00000215474
AA Change: Y35C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000215829
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 T A 9: 26,979,248 N255Y probably damaging Het
Accsl A C 2: 93,866,145 L36R probably benign Het
Acvr2a T A 2: 48,873,457 V171E probably benign Het
Adgrl3 A G 5: 81,646,604 I491V probably benign Het
Ak9 G A 10: 41,317,846 probably null Het
Ak9 G T 10: 41,382,873 E789* probably null Het
Akr1c19 T A 13: 4,243,071 N275K probably benign Het
Alg1 A G 16: 5,243,693 H398R probably benign Het
Apol11a T A 15: 77,517,009 I232N probably damaging Het
Cacnb2 A G 2: 14,984,269 I437V probably benign Het
Catsper4 A G 4: 134,227,106 probably null Het
Crnn T C 3: 93,148,302 C132R probably benign Het
Cyp4a14 T A 4: 115,491,356 H337L probably damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dclre1b T C 3: 103,803,338 N419S probably benign Het
Dip2c A G 13: 9,575,467 D621G possibly damaging Het
Dmwd T A 7: 19,080,769 L448Q probably damaging Het
Dnajc13 G A 9: 104,165,788 H1922Y probably benign Het
E2f3 A T 13: 29,911,318 I329N probably damaging Het
Eml2 G A 7: 19,194,063 V266M probably benign Het
Entpd2 A G 2: 25,399,713 T376A probably benign Het
Flnb A G 14: 7,908,671 T1350A probably benign Het
Fmnl2 A G 2: 53,126,065 E999G unknown Het
Gm28710 G A 5: 16,823,154 G449D probably benign Het
Hivep1 A G 13: 42,158,931 Q1549R possibly damaging Het
Hps6 G A 19: 46,004,007 V128M possibly damaging Het
Ifi27 T C 12: 103,436,640 S66P possibly damaging Het
Ikbip T C 10: 91,096,325 V277A possibly damaging Het
Ints8 T C 4: 11,230,488 E451G probably benign Het
Itih2 A T 2: 10,127,789 S64T probably benign Het
Kcnc4 T A 3: 107,448,136 E332V probably damaging Het
Lrpprc C A 17: 84,771,492 G265C probably damaging Het
Nav1 G T 1: 135,585,205 A39E probably benign Het
Ogfod1 G T 8: 94,047,278 D103Y probably damaging Het
Olfr835 T G 9: 19,035,482 Y120D probably damaging Het
Olfr922 G A 9: 38,815,989 C162Y probably damaging Het
Olfr970 A G 9: 39,819,956 T106A probably benign Het
Ppp1r3a A T 6: 14,755,015 S78T probably damaging Het
Rnf148 A T 6: 23,654,541 V152E probably damaging Het
Sdf2 A T 11: 78,246,144 H50L probably damaging Het
Sec1 T A 7: 45,679,276 M116L probably benign Het
Sema6d T C 2: 124,654,194 S53P probably damaging Het
Slc18b1 A T 10: 23,810,853 Y189F probably damaging Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Strn4 G A 7: 16,826,645 E241K probably benign Het
Svep1 A G 4: 58,135,578 I510T possibly damaging Het
Svop T C 5: 114,032,793 D395G probably damaging Het
Tbc1d14 A C 5: 36,571,544 S159R probably damaging Het
Tex50 T A 1: 161,157,278 I131F possibly damaging Het
Tssk1 A G 16: 17,895,020 K223R probably benign Het
Ttc3 A G 16: 94,451,143 I1565V probably benign Het
Ttn A T 2: 76,711,594 F33683I possibly damaging Het
Ttn T C 2: 76,953,126 M887V unknown Het
Usp45 G A 4: 21,815,399 probably null Het
Xirp1 A G 9: 120,017,805 S671P probably benign Het
Zbtb18 A G 1: 177,447,116 D5G probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp260 T G 7: 30,105,489 Y271* probably null Het
Zfp369 T A 13: 65,297,268 S742T possibly damaging Het
Zfp786 A T 6: 47,825,081 D87E probably damaging Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7697:Siae UTSW 9 37633654 missense probably damaging 1.00
R7821:Siae UTSW 9 37644900 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8312:Siae UTSW 9 37646297 missense
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGGTTGGCCAAGAACTGTG -3'
(R):5'- CATTTTCAGATAATCCAGCAGGTG -3'

Sequencing Primer
(F):5'- TTTAATCTGGAGCAACTGGACCCG -3'
(R):5'- TGGCAGAAGAGGACAATAACTGAAC -3'
Posted On2021-07-15