Incidental Mutation 'R8868:Dip2c'
ID676101
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R8868 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9575467 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 621 (D621G)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: D621G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: D621G

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174552
AA Change: D621G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: D621G

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 T A 9: 26,979,248 N255Y probably damaging Het
Accsl A C 2: 93,866,145 L36R probably benign Het
Acvr2a T A 2: 48,873,457 V171E probably benign Het
Adgrl3 A G 5: 81,646,604 I491V probably benign Het
Ak9 G A 10: 41,317,846 probably null Het
Ak9 G T 10: 41,382,873 E789* probably null Het
Akr1c19 T A 13: 4,243,071 N275K probably benign Het
Alg1 A G 16: 5,243,693 H398R probably benign Het
Apol11a T A 15: 77,517,009 I232N probably damaging Het
Cacnb2 A G 2: 14,984,269 I437V probably benign Het
Catsper4 A G 4: 134,227,106 probably null Het
Crnn T C 3: 93,148,302 C132R probably benign Het
Cyp4a14 T A 4: 115,491,356 H337L probably damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dclre1b T C 3: 103,803,338 N419S probably benign Het
Dmwd T A 7: 19,080,769 L448Q probably damaging Het
Dnajc13 G A 9: 104,165,788 H1922Y probably benign Het
E2f3 A T 13: 29,911,318 I329N probably damaging Het
Eml2 G A 7: 19,194,063 V266M probably benign Het
Entpd2 A G 2: 25,399,713 T376A probably benign Het
Flnb A G 14: 7,908,671 T1350A probably benign Het
Fmnl2 A G 2: 53,126,065 E999G unknown Het
Gm28710 G A 5: 16,823,154 G449D probably benign Het
Hivep1 A G 13: 42,158,931 Q1549R possibly damaging Het
Hps6 G A 19: 46,004,007 V128M possibly damaging Het
Ifi27 T C 12: 103,436,640 S66P possibly damaging Het
Ikbip T C 10: 91,096,325 V277A possibly damaging Het
Ints8 T C 4: 11,230,488 E451G probably benign Het
Itih2 A T 2: 10,127,789 S64T probably benign Het
Kcnc4 T A 3: 107,448,136 E332V probably damaging Het
Lrpprc C A 17: 84,771,492 G265C probably damaging Het
Nav1 G T 1: 135,585,205 A39E probably benign Het
Ogfod1 G T 8: 94,047,278 D103Y probably damaging Het
Olfr835 T G 9: 19,035,482 Y120D probably damaging Het
Olfr922 G A 9: 38,815,989 C162Y probably damaging Het
Olfr970 A G 9: 39,819,956 T106A probably benign Het
Ppp1r3a A T 6: 14,755,015 S78T probably damaging Het
Rnf148 A T 6: 23,654,541 V152E probably damaging Het
Sdf2 A T 11: 78,246,144 H50L probably damaging Het
Sec1 T A 7: 45,679,276 M116L probably benign Het
Sema6d T C 2: 124,654,194 S53P probably damaging Het
Siae A G 9: 37,616,836 Y35C probably damaging Het
Slc18b1 A T 10: 23,810,853 Y189F probably damaging Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Strn4 G A 7: 16,826,645 E241K probably benign Het
Svep1 A G 4: 58,135,578 I510T possibly damaging Het
Svop T C 5: 114,032,793 D395G probably damaging Het
Tbc1d14 A C 5: 36,571,544 S159R probably damaging Het
Tex50 T A 1: 161,157,278 I131F possibly damaging Het
Tssk1 A G 16: 17,895,020 K223R probably benign Het
Ttc3 A G 16: 94,451,143 I1565V probably benign Het
Ttn A T 2: 76,711,594 F33683I possibly damaging Het
Ttn T C 2: 76,953,126 M887V unknown Het
Usp45 G A 4: 21,815,399 probably null Het
Xirp1 A G 9: 120,017,805 S671P probably benign Het
Zbtb18 A G 1: 177,447,116 D5G probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp260 T G 7: 30,105,489 Y271* probably null Het
Zfp369 T A 13: 65,297,268 S742T possibly damaging Het
Zfp786 A T 6: 47,825,081 D87E probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R8354:Dip2c UTSW 13 9621882 missense probably benign 0.05
R8685:Dip2c UTSW 13 9637125 missense probably benign 0.01
R8779:Dip2c UTSW 13 9610809 missense probably damaging 0.98
R8786:Dip2c UTSW 13 9615794 missense probably damaging 0.99
R8815:Dip2c UTSW 13 9623798 nonsense probably null
R8833:Dip2c UTSW 13 9575483 critical splice donor site probably null
R8873:Dip2c UTSW 13 9575146 missense probably benign 0.03
R8923:Dip2c UTSW 13 9623865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTTGGTCTCTCCTGGG -3'
(R):5'- ACCCTGGTCTTTAAGGAGAACAC -3'

Sequencing Primer
(F):5'- TGGTGACAAGATAATTCACCATTCCC -3'
(R):5'- GTCTTTAAGGAGAACACTGCTTTG -3'
Posted On2021-07-15