Incidental Mutation 'R8868:Hps6'
ID 676114
Institutional Source Beutler Lab
Gene Symbol Hps6
Ensembl Gene ENSMUSG00000074811
Gene Name HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms 5330434M19Rik, BLOC-2, ruby eye, ru
MMRRC Submission
Accession Numbers

MGI: 2181763

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8868 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46003478-46006173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46004007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000096991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099393]
AlphaFold Q8BLY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000099393
AA Change: V128M

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096991
Gene: ENSMUSG00000074811
AA Change: V128M

DomainStartEndE-ValueType
Pfam:HPS6 1 772 1e-281 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in hypopigmented hair and eyes, and increased clotting time due to a platelet dense granule defect. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Spontaneous(8) Chemically induced(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 T A 9: 26,979,248 N255Y probably damaging Het
Accsl A C 2: 93,866,145 L36R probably benign Het
Acvr2a T A 2: 48,873,457 V171E probably benign Het
Adgrl3 A G 5: 81,646,604 I491V probably benign Het
Ak9 G A 10: 41,317,846 probably null Het
Ak9 G T 10: 41,382,873 E789* probably null Het
Akr1c19 T A 13: 4,243,071 N275K probably benign Het
Alg1 A G 16: 5,243,693 H398R probably benign Het
Apol11a T A 15: 77,517,009 I232N probably damaging Het
Cacnb2 A G 2: 14,984,269 I437V probably benign Het
Catsper4 A G 4: 134,227,106 probably null Het
Crnn T C 3: 93,148,302 C132R probably benign Het
Cyp4a14 T A 4: 115,491,356 H337L probably damaging Het
Dcdc2a C T 13: 25,202,283 A380V probably benign Het
Dclre1b T C 3: 103,803,338 N419S probably benign Het
Dip2c A G 13: 9,575,467 D621G possibly damaging Het
Dmwd T A 7: 19,080,769 L448Q probably damaging Het
Dnajc13 G A 9: 104,165,788 H1922Y probably benign Het
E2f3 A T 13: 29,911,318 I329N probably damaging Het
Eml2 G A 7: 19,194,063 V266M probably benign Het
Entpd2 A G 2: 25,399,713 T376A probably benign Het
Flnb A G 14: 7,908,671 T1350A probably benign Het
Fmnl2 A G 2: 53,126,065 E999G unknown Het
Gm28710 G A 5: 16,823,154 G449D probably benign Het
Hivep1 A G 13: 42,158,931 Q1549R possibly damaging Het
Ifi27 T C 12: 103,436,640 S66P possibly damaging Het
Ikbip T C 10: 91,096,325 V277A possibly damaging Het
Ints8 T C 4: 11,230,488 E451G probably benign Het
Itih2 A T 2: 10,127,789 S64T probably benign Het
Kcnc4 T A 3: 107,448,136 E332V probably damaging Het
Krt23 T C 11: 99,483,741 probably benign Het
Lrpprc C A 17: 84,771,492 G265C probably damaging Het
Nav1 G T 1: 135,585,205 A39E probably benign Het
Ogfod1 G T 8: 94,047,278 D103Y probably damaging Het
Olfr835 T G 9: 19,035,482 Y120D probably damaging Het
Olfr922 G A 9: 38,815,989 C162Y probably damaging Het
Olfr970 A G 9: 39,819,956 T106A probably benign Het
Ppp1r3a A T 6: 14,755,015 S78T probably damaging Het
Rnf148 A T 6: 23,654,541 V152E probably damaging Het
Sdf2 A T 11: 78,246,144 H50L probably damaging Het
Sec1 T A 7: 45,679,276 M116L probably benign Het
Sema6d T C 2: 124,654,194 S53P probably damaging Het
Siae A G 9: 37,616,836 Y35C probably damaging Het
Slc18b1 A T 10: 23,810,853 Y189F probably damaging Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spef2 T C 15: 9,729,661 T124A possibly damaging Het
Strn4 G A 7: 16,826,645 E241K probably benign Het
Svep1 A G 4: 58,135,578 I510T possibly damaging Het
Svop T C 5: 114,032,793 D395G probably damaging Het
Tbc1d14 A C 5: 36,571,544 S159R probably damaging Het
Tex50 T A 1: 161,157,278 I131F possibly damaging Het
Tssk1 A G 16: 17,895,020 K223R probably benign Het
Ttc3 A G 16: 94,451,143 I1565V probably benign Het
Ttn A T 2: 76,711,594 F33683I possibly damaging Het
Ttn T C 2: 76,953,126 M887V unknown Het
Usp45 G A 4: 21,815,399 probably null Het
Wdr47 C T 3: 108,591,525 probably benign Het
Xirp1 A G 9: 120,017,805 S671P probably benign Het
Zbtb18 A G 1: 177,447,116 D5G probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfp260 T G 7: 30,105,489 Y271* probably null Het
Zfp369 T A 13: 65,297,268 S742T possibly damaging Het
Zfp786 A T 6: 47,825,081 D87E probably damaging Het
Other mutations in Hps6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hps6 APN 19 46003660 missense probably damaging 1.00
IGL02826:Hps6 APN 19 46006041 makesense probably null
stamper-coat UTSW 19 46003836 missense probably damaging 1.00
R0299:Hps6 UTSW 19 46004232 missense probably damaging 0.98
R0613:Hps6 UTSW 19 46003821 missense probably benign
R1036:Hps6 UTSW 19 46004241 missense probably benign 0.00
R1845:Hps6 UTSW 19 46004970 missense probably benign 0.30
R1959:Hps6 UTSW 19 46004335 missense probably benign 0.33
R2271:Hps6 UTSW 19 46005682 missense possibly damaging 0.86
R2332:Hps6 UTSW 19 46004491 missense possibly damaging 0.82
R3156:Hps6 UTSW 19 46003741 missense probably damaging 1.00
R3937:Hps6 UTSW 19 46004053 missense probably damaging 0.97
R7108:Hps6 UTSW 19 46005490 missense probably damaging 1.00
R7384:Hps6 UTSW 19 46004017 missense possibly damaging 0.96
R7710:Hps6 UTSW 19 46004568 missense probably benign 0.03
R8444:Hps6 UTSW 19 46005428 missense possibly damaging 0.72
R8530:Hps6 UTSW 19 46003520 start gained probably benign
R8773:Hps6 UTSW 19 46005702 missense possibly damaging 0.92
R9329:Hps6 UTSW 19 46004103 missense probably benign 0.00
R9385:Hps6 UTSW 19 46005910 missense probably damaging 0.97
X0065:Hps6 UTSW 19 46004166 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CACTTGCTGCTATTAAGACCCC -3'
(R):5'- TGTTGGTAGTAGGCACCAGG -3'

Sequencing Primer
(F):5'- CCCACAGCTTCTAGTGGC -3'
(R):5'- CTTGCGGGAGGCTATCAGTC -3'
Posted On 2021-07-15