Incidental Mutation 'R8869:Malrd1'
ID676120
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene NameMAM and LDL receptor class A domain containing 1
SynonymsDiet1, Gm13364, Gm13318
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8869 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location15526479-16255555 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 15565557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
Predicted Effect probably null
Transcript: ENSMUST00000146205
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,272,632 Y242C probably damaging Het
4833427G06Rik T A 9: 51,081,532 probably null Het
4932438A13Rik T A 3: 36,958,858 C1895S probably damaging Het
Acsl5 G A 19: 55,278,091 R114Q possibly damaging Het
Atp1a4 C T 1: 172,227,123 V980I probably benign Het
Brd1 A T 15: 88,730,526 D55E probably benign Het
Cachd1 A G 4: 100,952,083 D255G probably benign Het
Ces2f C A 8: 104,950,072 P133T probably damaging Het
Clock GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 5: 76,227,042 probably benign Het
Cyp4f37 A T 17: 32,625,122 I67F probably benign Het
Dbf4 T C 5: 8,398,656 I84V Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhdh G T 7: 45,488,112 N50K probably benign Het
Dnah7c A T 1: 46,632,344 E1631V probably damaging Het
Dusp23 A G 1: 172,632,726 C53R possibly damaging Het
Efcab6 G A 15: 84,044,231 S54L probably damaging Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Gfap G C 11: 102,896,984 A45G probably benign Het
Gm6614 A G 6: 141,982,084 V548A probably damaging Het
Gm8251 A T 1: 44,058,265 D1224E possibly damaging Het
Grm8 C T 6: 27,363,753 V588M probably benign Het
H1foo A G 6: 115,949,950 T263A probably benign Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh15 T C 16: 49,177,003 V1728A probably benign Het
Nxph2 T A 2: 23,400,059 V141D probably damaging Het
Olfr1128 A T 2: 87,545,409 M45K probably damaging Het
Olfr1163 T A 2: 88,071,409 probably null Het
Olfr1310 A T 2: 112,008,251 S312T possibly damaging Het
Olfr1395 A T 11: 49,148,656 Y133F probably damaging Het
Olfr1480 A T 19: 13,530,528 N329I probably damaging Het
Olfr193 A G 16: 59,109,758 V284A Het
Olfr250 A G 9: 38,367,846 N90S possibly damaging Het
Olfr323 T C 11: 58,625,168 E106G unknown Het
Otof T A 5: 30,420,981 I108F probably benign Het
Pcdha4 A T 18: 36,952,958 R65* probably null Het
Pde11a T C 2: 76,211,090 H412R probably benign Het
Peli3 C T 19: 4,932,513 G375S probably damaging Het
Ppp6r3 A G 19: 3,511,927 probably null Het
Prcp T C 7: 92,910,310 V194A possibly damaging Het
Prkce T C 17: 86,168,942 probably null Het
Prss23 A T 7: 89,510,679 S61T probably benign Het
Ptprq C T 10: 107,699,608 R432H probably damaging Het
Rnase2a T A 14: 51,255,644 N88I possibly damaging Het
Rspry1 G T 8: 94,633,152 L230F probably damaging Het
Smpd2 A G 10: 41,489,305 L65P probably benign Het
Sorl1 A G 9: 42,022,426 Y1083H probably benign Het
Tjp1 A G 7: 65,336,638 S241P probably damaging Het
Tmed6 A C 8: 107,065,532 L27R probably damaging Het
Tmem52 G A 4: 155,469,331 C32Y probably damaging Het
Tmprss15 C A 16: 78,953,946 G1022* probably null Het
Ttn T C 2: 76,900,001 S5085G unknown Het
Vmn2r37 C T 7: 9,206,855 V553M possibly damaging Het
Wdr66 A T 5: 123,322,442 M1156L possibly damaging Het
Wdr70 A T 15: 8,093,726 M42K probably benign Het
Zfp735 T A 11: 73,711,684 C485S possibly damaging Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16142186 splice site probably benign
IGL01295:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01296:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01399:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01400:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01401:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01402:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01405:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01406:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL02105:Malrd1 APN 2 16127863 missense unknown
IGL02581:Malrd1 APN 2 16142312 nonsense probably null
IGL03015:Malrd1 APN 2 16042271 missense unknown
IGL03038:Malrd1 APN 2 16127967 missense unknown
R1353:Malrd1 UTSW 2 16127968 missense unknown
R1385:Malrd1 UTSW 2 16042228 missense unknown
R2242:Malrd1 UTSW 2 16101944 missense unknown
R2888:Malrd1 UTSW 2 16074757 missense unknown
R4398:Malrd1 UTSW 2 16150783 missense unknown
R4982:Malrd1 UTSW 2 16042129 missense probably benign 0.29
R5148:Malrd1 UTSW 2 16142226 missense unknown
R5195:Malrd1 UTSW 2 16150810 missense unknown
R5828:Malrd1 UTSW 2 15526653 missense probably benign 0.00
R5892:Malrd1 UTSW 2 15614267 missense probably benign 0.03
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15695326 missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16042267 missense unknown
R6438:Malrd1 UTSW 2 15614206 missense
R6457:Malrd1 UTSW 2 15526597 start gained probably benign
R6457:Malrd1 UTSW 2 15667929 missense probably benign 0.41
R6499:Malrd1 UTSW 2 15931689 missense probably benign 0.03
R6575:Malrd1 UTSW 2 15842628 missense probably benign 0.00
R6792:Malrd1 UTSW 2 16150756 missense unknown
R6796:Malrd1 UTSW 2 15869784 missense unknown
R6930:Malrd1 UTSW 2 15797667 missense unknown
R6959:Malrd1 UTSW 2 16218009 missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16150791 missense unknown
R7102:Malrd1 UTSW 2 16142303 missense unknown
R7112:Malrd1 UTSW 2 15925176 missense unknown
R7248:Malrd1 UTSW 2 16101911 missense unknown
R7249:Malrd1 UTSW 2 15623340 missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16006718 missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15695199 missense unknown
R7399:Malrd1 UTSW 2 15610090 missense
R7476:Malrd1 UTSW 2 16142304 missense unknown
R7582:Malrd1 UTSW 2 15695270 missense unknown
R7604:Malrd1 UTSW 2 15925192 missense unknown
R7662:Malrd1 UTSW 2 15871454 missense unknown
R7681:Malrd1 UTSW 2 16218102 missense unknown
R7740:Malrd1 UTSW 2 15614215 missense not run
R7747:Malrd1 UTSW 2 16074835 missense unknown
R7754:Malrd1 UTSW 2 15797799 splice site probably null
R7950:Malrd1 UTSW 2 16128068 missense unknown
R8194:Malrd1 UTSW 2 15925120 missense unknown
R8260:Malrd1 UTSW 2 15614206 missense
R8314:Malrd1 UTSW 2 15752832 missense unknown
R8342:Malrd1 UTSW 2 15633224 missense unknown
R8386:Malrd1 UTSW 2 15696844 missense unknown
R8492:Malrd1 UTSW 2 15610123 missense
R8728:Malrd1 UTSW 2 15696942 nonsense probably null
R8756:Malrd1 UTSW 2 15752895 critical splice donor site probably null
R8888:Malrd1 UTSW 2 15845227 missense unknown
R8895:Malrd1 UTSW 2 15845227 missense unknown
R8902:Malrd1 UTSW 2 16255334 nonsense probably null
R8954:Malrd1 UTSW 2 15551367 missense
R8960:Malrd1 UTSW 2 15565430 nonsense probably null
Z1176:Malrd1 UTSW 2 16217845 missense unknown
Z1191:Malrd1 UTSW 2 16042226 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACACACTTGGCAATTCCC -3'
(R):5'- GAAATGAGCTTACCCGTAAGATG -3'

Sequencing Primer
(F):5'- GCAAATTGATAGCAGGCC -3'
(R):5'- GAGCTTACCCGTAAGATGAATATAAG -3'
Posted On2021-07-15