Incidental Mutation 'R0732:Atf2'
ID67613
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Nameactivating transcription factor 2
SynonymsD130078H02Rik, mXBP, Creb2, ATF-2, CRE-BP
MMRRC Submission 038913-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R0732 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73816509-73892639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73845500 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 169 (M169K)
Ref Sequence ENSEMBL: ENSMUSP00000107641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000128531] [ENSMUST00000136958] [ENSMUST00000154456] [ENSMUST00000173010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055833
AA Change: M209K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104
AA Change: M209K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090802
AA Change: M169K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104
AA Change: M169K

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100009
AA Change: M209K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104
AA Change: M209K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112007
AA Change: M169K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104
AA Change: M169K

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112010
AA Change: M169K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104
AA Change: M169K

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112016
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112017
AA Change: M209K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104
AA Change: M209K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124737
AA Change: M2K
SMART Domains Protein: ENSMUSP00000114828
Gene: ENSMUSG00000027104
AA Change: M2K

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
BRLZ 126 190 3.89e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128531
AA Change: M209K

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118560
Gene: ENSMUSG00000027104
AA Change: M209K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129555
Predicted Effect probably benign
Transcript: ENSMUST00000136958
SMART Domains Protein: ENSMUSP00000118357
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143714
Predicted Effect probably benign
Transcript: ENSMUST00000154456
AA Change: M126K

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156455
Predicted Effect probably benign
Transcript: ENSMUST00000173010
AA Change: M209K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104
AA Change: M209K

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,546,448 Y1175C probably damaging Het
Acsm3 T C 7: 119,773,834 S187P probably benign Het
Adam28 T C 14: 68,637,347 I294V probably benign Het
Adgrv1 T C 13: 81,503,004 I3057M possibly damaging Het
Aff4 T C 11: 53,375,596 V304A probably benign Het
Akr1b10 T C 6: 34,390,109 Y108H probably benign Het
Ankib1 T C 5: 3,713,163 N522S possibly damaging Het
Ano1 T A 7: 144,619,488 probably null Het
Antxr2 G T 5: 97,960,708 probably null Het
Arc G A 15: 74,671,195 T393I probably damaging Het
Arhgef33 A G 17: 80,381,354 D5G possibly damaging Het
BC005624 T A 2: 30,973,937 T215S possibly damaging Het
BC048403 T C 10: 121,750,947 V253A possibly damaging Het
Bmp8b G A 4: 123,105,406 G19D unknown Het
Cacna1d T C 14: 30,042,920 N1987S probably damaging Het
Camta1 T A 4: 151,586,484 probably null Het
Catsperg2 C T 7: 29,700,696 G316D probably damaging Het
Cbs G T 17: 31,625,029 N209K probably benign Het
Ccdc122 T A 14: 77,091,759 M84K probably damaging Het
Cd5 C T 19: 10,723,285 C285Y probably damaging Het
Chpf2 T C 5: 24,590,421 M1T probably null Het
Coch T A 12: 51,595,372 D42E probably damaging Het
Crip2 C T 12: 113,140,558 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Cxcl16 G T 11: 70,455,408 P233H probably damaging Het
Cyfip1 T C 7: 55,886,781 I319T probably damaging Het
Ddhd2 T C 8: 25,741,321 Q364R probably damaging Het
Ephx2 A G 14: 66,086,963 probably null Het
Exoc6b C A 6: 84,855,522 V397L probably damaging Het
Fam83b T A 9: 76,492,928 K298* probably null Het
Fbxo8 T A 8: 56,591,529 I289N probably damaging Het
Fkbp9 T A 6: 56,878,104 M536K probably benign Het
Flot1 C T 17: 35,825,524 R190W possibly damaging Het
Gbp2b T A 3: 142,606,978 V374E probably benign Het
Gm884 T C 11: 103,619,838 T435A unknown Het
Gna15 T A 10: 81,512,556 S114C probably damaging Het
Gstt4 T A 10: 75,817,321 T136S probably benign Het
Hcn3 C T 3: 89,148,786 V524M probably damaging Het
Kctd16 A T 18: 40,258,563 D68V probably damaging Het
Krt90 G T 15: 101,560,425 F227L possibly damaging Het
Maip1 A G 1: 57,411,835 Y212C probably damaging Het
Mamdc2 C T 19: 23,378,869 D72N probably damaging Het
Marveld3 A T 8: 109,948,483 Y234N probably damaging Het
Mas1 A G 17: 12,841,747 I263T probably benign Het
Matk T A 10: 81,258,306 probably null Het
Mrgpre T A 7: 143,781,566 I67F possibly damaging Het
Mthfd1 T A 12: 76,294,174 I449N probably damaging Het
Nacc1 C T 8: 84,676,201 R321Q probably damaging Het
Neb T C 2: 52,258,681 D2618G probably damaging Het
Neb T C 2: 52,291,268 Y1109C probably damaging Het
Nell1 T G 7: 50,856,387 W781G probably damaging Het
Olfr1037 A C 2: 86,085,584 S64R probably benign Het
Olfr1269 A G 2: 90,119,322 V92A probably benign Het
Olfr1279 T A 2: 111,306,980 Y258* probably null Het
Olfr281 T C 15: 98,457,078 L256S possibly damaging Het
Olfr424 A T 1: 174,137,415 I224F possibly damaging Het
Olfr497 C A 7: 108,422,577 A2D probably benign Het
Olfr544 T C 7: 102,484,443 I226V probably benign Het
Olfr646 T C 7: 104,106,294 L5P probably damaging Het
Pcdh7 C A 5: 57,721,315 D737E probably damaging Het
Pdss1 T G 2: 22,901,312 M55R probably benign Het
Pex6 C T 17: 46,724,700 R889W probably damaging Het
Pigl T A 11: 62,458,481 C8S possibly damaging Het
Plekha7 A T 7: 116,145,237 M585K probably damaging Het
Ppp1r1a C T 15: 103,533,087 M66I possibly damaging Het
Ptcd3 A T 6: 71,881,171 probably benign Het
Rhov A T 2: 119,271,014 V37E probably damaging Het
Rnf213 A T 11: 119,441,068 M2368L probably damaging Het
Skida1 T C 2: 18,046,157 probably benign Het
Slc25a28 T C 19: 43,666,953 D161G probably benign Het
Smc6 T C 12: 11,290,817 V490A probably damaging Het
Sohlh2 T A 3: 55,190,373 probably null Het
Stk31 A G 6: 49,417,495 T264A probably benign Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tacr1 T A 6: 82,552,901 V200E probably damaging Het
Tbrg4 C T 11: 6,620,812 R220H probably benign Het
Tcf20 A G 15: 82,852,303 L1649P probably benign Het
Tcirg1 A T 19: 3,897,866 L523Q possibly damaging Het
Tinag T A 9: 77,001,654 K335M possibly damaging Het
Tkt T G 14: 30,571,140 probably null Het
Tnpo1 C T 13: 98,863,812 R349H probably damaging Het
Trim26 T A 17: 36,852,618 S230R possibly damaging Het
Trim8 T A 19: 46,514,739 probably null Het
Trp53bp1 T C 2: 121,248,264 R326G probably null Het
Ugt2a2 A T 5: 87,460,639 I613N probably damaging Het
Vmn1r32 T C 6: 66,553,706 I29V probably benign Het
Wnt5b C T 6: 119,446,582 W27* probably null Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73845503 missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73819078 missense probably damaging 1.00
IGL02112:Atf2 APN 2 73819037 missense probably damaging 1.00
IGL02469:Atf2 APN 2 73846332 missense probably damaging 0.99
IGL02686:Atf2 APN 2 73845500 missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73828668 missense probably benign 0.13
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0480:Atf2 UTSW 2 73819156 splice site probably benign
R1188:Atf2 UTSW 2 73845537 missense probably damaging 0.96
R1285:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1287:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1523:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R1622:Atf2 UTSW 2 73853789 splice site probably null
R1731:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1935:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1939:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1965:Atf2 UTSW 2 73850898 missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73863240 critical splice acceptor site probably null
R2045:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R2256:Atf2 UTSW 2 73845511 intron probably null
R3147:Atf2 UTSW 2 73850939 synonymous probably null
R3890:Atf2 UTSW 2 73863213 missense probably damaging 1.00
R4680:Atf2 UTSW 2 73828681 splice site probably null
R4715:Atf2 UTSW 2 73823300 missense probably damaging 1.00
R5161:Atf2 UTSW 2 73829790 critical splice donor site probably null
R5853:Atf2 UTSW 2 73828469 splice site probably null
R7419:Atf2 UTSW 2 73842433 missense probably benign 0.01
X0033:Atf2 UTSW 2 73846281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACCTAGTCAAACTGGAGTGAGGTGAAT -3'
(R):5'- AGTAACTCCCAAGACCTTTCTGATGAGA -3'

Sequencing Primer
(F):5'- GGTTTCAATCCAATTATGTTTGCC -3'
(R):5'- GGAAATCCATGATTTTTCCCCAGG -3'
Posted On2013-09-03