Incidental Mutation 'R8869:Rspry1'
ID676142
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R8869 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94633152 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 230 (L230F)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: L230F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: L230F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: L230F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000212729
AA Change: L106F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,272,632 Y242C probably damaging Het
4833427G06Rik T A 9: 51,081,532 probably null Het
4932438A13Rik T A 3: 36,958,858 C1895S probably damaging Het
Acsl5 G A 19: 55,278,091 R114Q possibly damaging Het
Atp1a4 C T 1: 172,227,123 V980I probably benign Het
Brd1 A T 15: 88,730,526 D55E probably benign Het
Cachd1 A G 4: 100,952,083 D255G probably benign Het
Ces2f C A 8: 104,950,072 P133T probably damaging Het
Clock GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 5: 76,227,042 probably benign Het
Cyp4f37 A T 17: 32,625,122 I67F probably benign Het
Dbf4 T C 5: 8,398,656 I84V Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhdh G T 7: 45,488,112 N50K probably benign Het
Dnah7c A T 1: 46,632,344 E1631V probably damaging Het
Dusp23 A G 1: 172,632,726 C53R possibly damaging Het
Efcab6 G A 15: 84,044,231 S54L probably damaging Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Gfap G C 11: 102,896,984 A45G probably benign Het
Gm6614 A G 6: 141,982,084 V548A probably damaging Het
Gm8251 A T 1: 44,058,265 D1224E possibly damaging Het
Grm8 C T 6: 27,363,753 V588M probably benign Het
H1foo A G 6: 115,949,950 T263A probably benign Het
Malrd1 T A 2: 15,565,557 probably null Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh15 T C 16: 49,177,003 V1728A probably benign Het
Nxph2 T A 2: 23,400,059 V141D probably damaging Het
Olfr1128 A T 2: 87,545,409 M45K probably damaging Het
Olfr1163 T A 2: 88,071,409 probably null Het
Olfr1310 A T 2: 112,008,251 S312T possibly damaging Het
Olfr1395 A T 11: 49,148,656 Y133F probably damaging Het
Olfr1480 A T 19: 13,530,528 N329I probably damaging Het
Olfr193 A G 16: 59,109,758 V284A Het
Olfr250 A G 9: 38,367,846 N90S possibly damaging Het
Olfr323 T C 11: 58,625,168 E106G unknown Het
Otof T A 5: 30,420,981 I108F probably benign Het
Pcdha4 A T 18: 36,952,958 R65* probably null Het
Pde11a T C 2: 76,211,090 H412R probably benign Het
Peli3 C T 19: 4,932,513 G375S probably damaging Het
Ppp6r3 A G 19: 3,511,927 probably null Het
Prcp T C 7: 92,910,310 V194A possibly damaging Het
Prkce T C 17: 86,168,942 probably null Het
Prss23 A T 7: 89,510,679 S61T probably benign Het
Ptprq C T 10: 107,699,608 R432H probably damaging Het
Rnase2a T A 14: 51,255,644 N88I possibly damaging Het
Smpd2 A G 10: 41,489,305 L65P probably benign Het
Sorl1 A G 9: 42,022,426 Y1083H probably benign Het
Tjp1 A G 7: 65,336,638 S241P probably damaging Het
Tmed6 A C 8: 107,065,532 L27R probably damaging Het
Tmem52 G A 4: 155,469,331 C32Y probably damaging Het
Tmprss15 C A 16: 78,953,946 G1022* probably null Het
Ttn T C 2: 76,900,001 S5085G unknown Het
Vmn2r37 C T 7: 9,206,855 V553M possibly damaging Het
Wdr66 A T 5: 123,322,442 M1156L possibly damaging Het
Wdr70 A T 15: 8,093,726 M42K probably benign Het
Zfp735 T A 11: 73,711,684 C485S possibly damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R7978:Rspry1 UTSW 8 94623125 missense probably damaging 0.98
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8174:Rspry1 UTSW 8 94649822 missense probably damaging 0.97
R8326:Rspry1 UTSW 8 94639589 missense probably damaging 1.00
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8715:Rspry1 UTSW 8 94623260 missense probably damaging 0.98
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTCTCTTTATGGTGAACTCAGTTGC -3'
(R):5'- TTTCTGTCTCTAAACATAGGCGG -3'

Sequencing Primer
(F):5'- TGGTGAACTCAGTTGCTACAC -3'
(R):5'- CATAGGCGGTGTTAAATAAAAACCC -3'
Posted On2021-07-15