Incidental Mutation 'R8869:Tmprss15'
ID676161
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8869 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 78953946 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 1022 (G1022*)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000023568] [ENSMUST00000060402] [ENSMUST00000069148] [ENSMUST00000232415]
Predicted Effect probably null
Transcript: ENSMUST00000023566
AA Change: G1022*
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: G1022*

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023568
SMART Domains Protein: ENSMUSP00000023568
Gene: ENSMUSG00000022860

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060402
AA Change: G1007*
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: G1007*

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069148
SMART Domains Protein: ENSMUSP00000063961
Gene: ENSMUSG00000022860

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232415
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,272,632 Y242C probably damaging Het
4833427G06Rik T A 9: 51,081,532 probably null Het
4932438A13Rik T A 3: 36,958,858 C1895S probably damaging Het
Acsl5 G A 19: 55,278,091 R114Q possibly damaging Het
Atp1a4 C T 1: 172,227,123 V980I probably benign Het
Brd1 A T 15: 88,730,526 D55E probably benign Het
Cachd1 A G 4: 100,952,083 D255G probably benign Het
Ces2f C A 8: 104,950,072 P133T probably damaging Het
Clock GGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTG 5: 76,227,042 probably benign Het
Cyp4f37 A T 17: 32,625,122 I67F probably benign Het
Dbf4 T C 5: 8,398,656 I84V Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhdh G T 7: 45,488,112 N50K probably benign Het
Dnah7c A T 1: 46,632,344 E1631V probably damaging Het
Dusp23 A G 1: 172,632,726 C53R possibly damaging Het
Efcab6 G A 15: 84,044,231 S54L probably damaging Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Gfap G C 11: 102,896,984 A45G probably benign Het
Gm6614 A G 6: 141,982,084 V548A probably damaging Het
Gm8251 A T 1: 44,058,265 D1224E possibly damaging Het
Grm8 C T 6: 27,363,753 V588M probably benign Het
H1foo A G 6: 115,949,950 T263A probably benign Het
Malrd1 T A 2: 15,565,557 probably null Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh15 T C 16: 49,177,003 V1728A probably benign Het
Nxph2 T A 2: 23,400,059 V141D probably damaging Het
Olfr1128 A T 2: 87,545,409 M45K probably damaging Het
Olfr1163 T A 2: 88,071,409 probably null Het
Olfr1310 A T 2: 112,008,251 S312T possibly damaging Het
Olfr1395 A T 11: 49,148,656 Y133F probably damaging Het
Olfr1480 A T 19: 13,530,528 N329I probably damaging Het
Olfr193 A G 16: 59,109,758 V284A Het
Olfr250 A G 9: 38,367,846 N90S possibly damaging Het
Olfr323 T C 11: 58,625,168 E106G unknown Het
Otof T A 5: 30,420,981 I108F probably benign Het
Pcdha4 A T 18: 36,952,958 R65* probably null Het
Pde11a T C 2: 76,211,090 H412R probably benign Het
Peli3 C T 19: 4,932,513 G375S probably damaging Het
Ppp6r3 A G 19: 3,511,927 probably null Het
Prcp T C 7: 92,910,310 V194A possibly damaging Het
Prkce T C 17: 86,168,942 probably null Het
Prss23 A T 7: 89,510,679 S61T probably benign Het
Ptprq C T 10: 107,699,608 R432H probably damaging Het
Rnase2a T A 14: 51,255,644 N88I possibly damaging Het
Rspry1 G T 8: 94,633,152 L230F probably damaging Het
Smpd2 A G 10: 41,489,305 L65P probably benign Het
Sorl1 A G 9: 42,022,426 Y1083H probably benign Het
Tjp1 A G 7: 65,336,638 S241P probably damaging Het
Tmed6 A C 8: 107,065,532 L27R probably damaging Het
Tmem52 G A 4: 155,469,331 C32Y probably damaging Het
Ttn T C 2: 76,900,001 S5085G unknown Het
Vmn2r37 C T 7: 9,206,855 V553M possibly damaging Het
Wdr66 A T 5: 123,322,442 M1156L possibly damaging Het
Wdr70 A T 15: 8,093,726 M42K probably benign Het
Zfp735 T A 11: 73,711,684 C485S possibly damaging Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 splice site probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 79071288 missense probably benign
R8537:Tmprss15 UTSW 16 79087515 missense probably damaging 0.99
R8735:Tmprss15 UTSW 16 79001814 missense possibly damaging 0.88
R8858:Tmprss15 UTSW 16 79057609 critical splice donor site probably null
R8884:Tmprss15 UTSW 16 79024769 missense probably benign 0.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCATCACTTATGTTTGGGTCAG -3'
(R):5'- TGCTCAGAGGTGTAGCATCAG -3'

Sequencing Primer
(F):5'- CACTTATGTTTGGGTCAGGAAAATGC -3'
(R):5'- ACCATTTGCGCCATCTCATG -3'
Posted On2021-07-15