Incidental Mutation 'R8870:Kif26b'
ID676176
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8870 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 178865029 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 512 (V512F)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably damaging
Transcript: ENSMUST00000160789
AA Change: V65F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: V65F

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161017
AA Change: V512F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: V512F

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,721 N1082Y possibly damaging Het
3110002H16Rik A G 18: 12,188,561 E473G probably benign Het
4930444P10Rik G A 1: 16,066,227 Q122* probably null Het
Ak8 C T 2: 28,735,590 T215M probably benign Het
Ano3 T A 2: 110,783,729 I210F probably benign Het
Atg9b A G 5: 24,387,034 F656L probably damaging Het
Bscl2 T C 19: 8,847,429 M292T probably benign Het
Cachd1 G T 4: 100,897,781 C143F probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccnb1ip1 C T 14: 50,791,993 G204E probably benign Het
Ccr1 T A 9: 123,963,985 L169F probably benign Het
Cdc42bpg A G 19: 6,314,520 N593D possibly damaging Het
Cdh20 T C 1: 104,945,323 S265P probably damaging Het
Cenpk A G 13: 104,230,857 E67G probably damaging Het
Cep76 A T 18: 67,640,120 I36K probably benign Het
Clock A T 5: 76,235,785 I507N probably benign Het
Cpne1 T C 2: 156,078,953 T110A probably benign Het
Crybg2 A T 4: 134,091,214 E1427V possibly damaging Het
Ctu1 A C 7: 43,675,322 K62Q probably damaging Het
Drd5 C A 5: 38,320,404 Q247K possibly damaging Het
Ect2l A T 10: 18,138,860 L808* probably null Het
Ficd A T 5: 113,738,187 D141V probably damaging Het
Fnbp1 A G 2: 31,048,210 Y148H Het
Gm11639 A G 11: 104,900,674 T2905A probably benign Het
Gm14409 T A 2: 177,265,519 Q62L probably benign Het
Gm49368 A G 7: 128,101,513 K485R probably benign Het
Gpr75 C A 11: 30,891,860 A255D probably benign Het
Hcrtr2 G T 9: 76,246,384 A242D probably damaging Het
Iapp G T 6: 142,298,876 V10F probably benign Het
Ikzf2 A G 1: 69,683,258 S31P possibly damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Itpkb A G 1: 180,332,179 probably benign Het
Itpr1 A G 6: 108,388,211 I874M probably damaging Het
Lhx6 G A 2: 36,105,220 probably benign Het
Lrfn1 A G 7: 28,459,493 E279G possibly damaging Het
Masp1 A C 16: 23,496,132 D126E probably damaging Het
Mef2a T C 7: 67,240,428 I299V probably benign Het
Midn A G 10: 80,150,105 S10G probably damaging Het
Mrps12 A T 7: 28,739,936 L118Q probably damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Mzf1 A G 7: 13,052,909 V78A probably benign Het
Ncoa6 A G 2: 155,421,158 V452A probably damaging Het
Neb A G 2: 52,161,469 Y6600H probably damaging Het
Nlgn2 A G 11: 69,825,471 L748P possibly damaging Het
Nnmt A T 9: 48,603,501 L72H probably damaging Het
Nrxn3 A G 12: 90,204,786 T964A probably benign Het
Olfr1277 T A 2: 111,270,119 I83F possibly damaging Het
Olfr1388 T A 11: 49,444,523 V224E probably damaging Het
Olfr197 G A 16: 59,185,767 P239S unknown Het
Olfr251 A G 9: 38,378,424 N175S probably benign Het
Olfr360 A G 2: 37,068,970 I222V probably benign Het
Olfr395 T G 11: 73,906,899 M198L probably benign Het
Olfr952 A G 9: 39,426,252 V273A probably damaging Het
Osbpl11 A G 16: 33,214,480 N280D probably benign Het
Peg10 A T 6: 4,754,825 Y202F probably damaging Het
Pick1 A G 15: 79,255,907 R469G unknown Het
Rev3l A G 10: 39,862,790 I2847V probably damaging Het
Rnaseh2b T A 14: 62,332,168 L18Q probably damaging Het
Rpl19 A G 11: 98,029,789 Y122C probably benign Het
Selp A G 1: 164,137,218 Y483C probably damaging Het
Setd2 T A 9: 110,594,253 F347L Het
Snx14 A G 9: 88,413,488 I208T probably benign Het
Spag16 T A 1: 69,996,858 F348L probably benign Het
Spata22 A T 11: 73,340,265 N115I probably damaging Het
Spata31 T C 13: 64,921,004 V322A probably benign Het
Spata5 A G 3: 37,448,512 N607D probably benign Het
Stc1 A T 14: 69,038,376 H206L probably benign Het
Tas2r129 A G 6: 132,951,559 D153G probably damaging Het
Tmem196 T A 12: 120,018,533 N167K possibly damaging Het
Tmpo T C 10: 91,151,719 T356A probably damaging Het
Tnks A G 8: 34,847,279 probably null Het
Ttbk1 A C 17: 46,470,735 L364R probably damaging Het
Vmn1r176 A T 7: 23,835,055 N224K probably damaging Het
Vmn1r36 T A 6: 66,716,736 M52L probably benign Het
Vmn2r93 A T 17: 18,305,058 H326L possibly damaging Het
Wdr78 C T 4: 103,087,332 probably null Het
Wrn A T 8: 33,329,192 M244K probably benign Het
Zcchc24 C T 14: 25,757,154 A102T probably benign Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R7954:Kif26b UTSW 1 178869379 missense probably damaging 0.99
R7960:Kif26b UTSW 1 178678919 missense probably damaging 1.00
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
R8152:Kif26b UTSW 1 178679229 missense possibly damaging 0.46
R8320:Kif26b UTSW 1 178884076 critical splice donor site probably null
R8360:Kif26b UTSW 1 178916373 missense probably benign 0.18
R8428:Kif26b UTSW 1 178917358 missense probably benign 0.09
R8670:Kif26b UTSW 1 178913784 missense probably damaging 1.00
R8737:Kif26b UTSW 1 178864865 missense probably damaging 0.99
R8788:Kif26b UTSW 1 178529525 start gained probably benign
R8854:Kif26b UTSW 1 178916383 missense possibly damaging 0.93
R8963:Kif26b UTSW 1 178916149 missense probably benign 0.00
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAGCCCGCTCTTTAATCCG -3'
(R):5'- ACTTGGAAGAGCTGGGGTATTC -3'

Sequencing Primer
(F):5'- CAGGTGAAAGTCATGCTGCGTATC -3'
(R):5'- ATTCCGTGGAGCTCAGAATGACTTC -3'
Posted On2021-07-15