Incidental Mutation 'R8870:Itpr1'
ID676198
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R8870 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108388211 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 874 (I874M)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032192
AA Change: I874M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: I874M

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203615
AA Change: I874M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: I874M

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212125
AA Change: I33M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,721 N1082Y possibly damaging Het
3110002H16Rik A G 18: 12,188,561 E473G probably benign Het
4930444P10Rik G A 1: 16,066,227 Q122* probably null Het
Ak8 C T 2: 28,735,590 T215M probably benign Het
Ano3 T A 2: 110,783,729 I210F probably benign Het
Atg9b A G 5: 24,387,034 F656L probably damaging Het
Bscl2 T C 19: 8,847,429 M292T probably benign Het
Cachd1 G T 4: 100,897,781 C143F probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccnb1ip1 C T 14: 50,791,993 G204E probably benign Het
Ccr1 T A 9: 123,963,985 L169F probably benign Het
Cdc42bpg A G 19: 6,314,520 N593D possibly damaging Het
Cdh20 T C 1: 104,945,323 S265P probably damaging Het
Cenpk A G 13: 104,230,857 E67G probably damaging Het
Cep76 A T 18: 67,640,120 I36K probably benign Het
Clock A T 5: 76,235,785 I507N probably benign Het
Cpne1 T C 2: 156,078,953 T110A probably benign Het
Crybg2 A T 4: 134,091,214 E1427V possibly damaging Het
Ctu1 A C 7: 43,675,322 K62Q probably damaging Het
Drd5 C A 5: 38,320,404 Q247K possibly damaging Het
Ect2l A T 10: 18,138,860 L808* probably null Het
Ficd A T 5: 113,738,187 D141V probably damaging Het
Fnbp1 A G 2: 31,048,210 Y148H Het
Gm11639 A G 11: 104,900,674 T2905A probably benign Het
Gm14409 T A 2: 177,265,519 Q62L probably benign Het
Gm49368 A G 7: 128,101,513 K485R probably benign Het
Gpr75 C A 11: 30,891,860 A255D probably benign Het
Hcrtr2 G T 9: 76,246,384 A242D probably damaging Het
Iapp G T 6: 142,298,876 V10F probably benign Het
Ikzf2 A G 1: 69,683,258 S31P possibly damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Itpkb A G 1: 180,332,179 probably benign Het
Kif26b G T 1: 178,865,029 V512F probably damaging Het
Lhx6 G A 2: 36,105,220 probably benign Het
Lrfn1 A G 7: 28,459,493 E279G possibly damaging Het
Masp1 A C 16: 23,496,132 D126E probably damaging Het
Mef2a T C 7: 67,240,428 I299V probably benign Het
Midn A G 10: 80,150,105 S10G probably damaging Het
Mrps12 A T 7: 28,739,936 L118Q probably damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Mzf1 A G 7: 13,052,909 V78A probably benign Het
Ncoa6 A G 2: 155,421,158 V452A probably damaging Het
Neb A G 2: 52,161,469 Y6600H probably damaging Het
Nlgn2 A G 11: 69,825,471 L748P possibly damaging Het
Nnmt A T 9: 48,603,501 L72H probably damaging Het
Nrxn3 A G 12: 90,204,786 T964A probably benign Het
Olfr1277 T A 2: 111,270,119 I83F possibly damaging Het
Olfr1388 T A 11: 49,444,523 V224E probably damaging Het
Olfr197 G A 16: 59,185,767 P239S unknown Het
Olfr251 A G 9: 38,378,424 N175S probably benign Het
Olfr360 A G 2: 37,068,970 I222V probably benign Het
Olfr395 T G 11: 73,906,899 M198L probably benign Het
Olfr952 A G 9: 39,426,252 V273A probably damaging Het
Osbpl11 A G 16: 33,214,480 N280D probably benign Het
Peg10 A T 6: 4,754,825 Y202F probably damaging Het
Pick1 A G 15: 79,255,907 R469G unknown Het
Rev3l A G 10: 39,862,790 I2847V probably damaging Het
Rnaseh2b T A 14: 62,332,168 L18Q probably damaging Het
Rpl19 A G 11: 98,029,789 Y122C probably benign Het
Selp A G 1: 164,137,218 Y483C probably damaging Het
Setd2 T A 9: 110,594,253 F347L Het
Snx14 A G 9: 88,413,488 I208T probably benign Het
Spag16 T A 1: 69,996,858 F348L probably benign Het
Spata22 A T 11: 73,340,265 N115I probably damaging Het
Spata31 T C 13: 64,921,004 V322A probably benign Het
Spata5 A G 3: 37,448,512 N607D probably benign Het
Stc1 A T 14: 69,038,376 H206L probably benign Het
Tas2r129 A G 6: 132,951,559 D153G probably damaging Het
Tmem196 T A 12: 120,018,533 N167K possibly damaging Het
Tmpo T C 10: 91,151,719 T356A probably damaging Het
Tnks A G 8: 34,847,279 probably null Het
Ttbk1 A C 17: 46,470,735 L364R probably damaging Het
Vmn1r176 A T 7: 23,835,055 N224K probably damaging Het
Vmn1r36 T A 6: 66,716,736 M52L probably benign Het
Vmn2r93 A T 17: 18,305,058 H326L possibly damaging Het
Wdr78 C T 4: 103,087,332 probably null Het
Wrn A T 8: 33,329,192 M244K probably benign Het
Zcchc24 C T 14: 25,757,154 A102T probably benign Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108438331 missense probably benign 0.28
R7449:Itpr1 UTSW 6 108389384 missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108403396 missense probably benign 0.05
R7502:Itpr1 UTSW 6 108383678 missense probably benign 0.00
R7779:Itpr1 UTSW 6 108523348 missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108482931 missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108523405 missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108417948 missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108386628 missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108438360 missense probably benign 0.18
R8200:Itpr1 UTSW 6 108394865 missense probably benign 0.00
R8242:Itpr1 UTSW 6 108386697 missense probably benign 0.44
R8322:Itpr1 UTSW 6 108388229 missense probably benign 0.05
R8377:Itpr1 UTSW 6 108510738 missense probably benign 0.00
R8412:Itpr1 UTSW 6 108363620 missense probably benign 0.07
R8443:Itpr1 UTSW 6 108519348 missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108393967 missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108523366 missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108377802 missense possibly damaging 0.79
R8921:Itpr1 UTSW 6 108378198 missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108493705 missense possibly damaging 0.86
Z1176:Itpr1 UTSW 6 108499149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACCCATTGCTTTATGATCTAG -3'
(R):5'- TGTCAGCACAGACAGACACTTC -3'

Sequencing Primer
(F):5'- GCTTTATGATCTAGTCATCCAGATGG -3'
(R):5'- GACACTTCAGATACTCACTCTTCAG -3'
Posted On2021-07-15