Incidental Mutation 'R8870:Tnks'
ID 676210
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8870 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 34826460-34965690 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34847279 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000033929
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,721 N1082Y possibly damaging Het
3110002H16Rik A G 18: 12,188,561 E473G probably benign Het
4930444P10Rik G A 1: 16,066,227 Q122* probably null Het
Ak8 C T 2: 28,735,590 T215M probably benign Het
Ano3 T A 2: 110,783,729 I210F probably benign Het
Atg9b A G 5: 24,387,034 F656L probably damaging Het
Bscl2 T C 19: 8,847,429 M292T probably benign Het
Cachd1 G T 4: 100,897,781 C143F probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccnb1ip1 C T 14: 50,791,993 G204E probably benign Het
Ccr1 T A 9: 123,963,985 L169F probably benign Het
Cdc42bpg A G 19: 6,314,520 N593D possibly damaging Het
Cdh20 T C 1: 104,945,323 S265P probably damaging Het
Cenpk A G 13: 104,230,857 E67G probably damaging Het
Cep76 A T 18: 67,640,120 I36K probably benign Het
Clock A T 5: 76,235,785 I507N probably benign Het
Cpne1 T C 2: 156,078,953 T110A probably benign Het
Crybg2 A T 4: 134,091,214 E1427V possibly damaging Het
Ctu1 A C 7: 43,675,322 K62Q probably damaging Het
Drd5 C A 5: 38,320,404 Q247K possibly damaging Het
Ect2l A T 10: 18,138,860 L808* probably null Het
Ficd A T 5: 113,738,187 D141V probably damaging Het
Fnbp1 A G 2: 31,048,210 Y148H Het
Gm11639 A G 11: 104,900,674 T2905A probably benign Het
Gm14409 T A 2: 177,265,519 Q62L probably benign Het
Gm49368 A G 7: 128,101,513 K485R probably benign Het
Gpr75 C A 11: 30,891,860 A255D probably benign Het
Hcrtr2 G T 9: 76,246,384 A242D probably damaging Het
Iapp G T 6: 142,298,876 V10F probably benign Het
Ikzf2 A G 1: 69,683,258 S31P possibly damaging Het
Il18rap G A 1: 40,525,120 probably benign Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Itpkb A G 1: 180,332,179 probably benign Het
Itpr1 A G 6: 108,388,211 I874M probably damaging Het
Kif26b G T 1: 178,865,029 V512F probably damaging Het
Lhx6 G A 2: 36,105,220 probably benign Het
Lrfn1 A G 7: 28,459,493 E279G possibly damaging Het
Masp1 A C 16: 23,496,132 D126E probably damaging Het
Mef2a T C 7: 67,240,428 I299V probably benign Het
Midn A G 10: 80,150,105 S10G probably damaging Het
Mrps12 A T 7: 28,739,936 L118Q probably damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Mzf1 A G 7: 13,052,909 V78A probably benign Het
Ncoa6 A G 2: 155,421,158 V452A probably damaging Het
Neb A G 2: 52,161,469 Y6600H probably damaging Het
Nlgn2 A G 11: 69,825,471 L748P possibly damaging Het
Nnmt A T 9: 48,603,501 L72H probably damaging Het
Nrxn3 A G 12: 90,204,786 T964A probably benign Het
Olfr1277 T A 2: 111,270,119 I83F possibly damaging Het
Olfr1388 T A 11: 49,444,523 V224E probably damaging Het
Olfr197 G A 16: 59,185,767 P239S unknown Het
Olfr251 A G 9: 38,378,424 N175S probably benign Het
Olfr360 A G 2: 37,068,970 I222V probably benign Het
Olfr395 T G 11: 73,906,899 M198L probably benign Het
Olfr952 A G 9: 39,426,252 V273A probably damaging Het
Osbpl11 A G 16: 33,214,480 N280D probably benign Het
Peg10 A T 6: 4,754,825 Y202F probably damaging Het
Pick1 A G 15: 79,255,907 R469G unknown Het
Rev3l A G 10: 39,862,790 I2847V probably damaging Het
Rnaseh2b T A 14: 62,332,168 L18Q probably damaging Het
Rpl19 A G 11: 98,029,789 Y122C probably benign Het
Selp A G 1: 164,137,218 Y483C probably damaging Het
Setd2 T A 9: 110,594,253 F347L Het
Snx14 A G 9: 88,413,488 I208T probably benign Het
Spag16 T A 1: 69,996,858 F348L probably benign Het
Spata22 A T 11: 73,340,265 N115I probably damaging Het
Spata31 T C 13: 64,921,004 V322A probably benign Het
Spata5 A G 3: 37,448,512 N607D probably benign Het
Stc1 A T 14: 69,038,376 H206L probably benign Het
Tas2r129 A G 6: 132,951,559 D153G probably damaging Het
Tmem196 T A 12: 120,018,533 N167K possibly damaging Het
Tmpo T C 10: 91,151,719 T356A probably damaging Het
Ttbk1 A C 17: 46,470,735 L364R probably damaging Het
Vmn1r176 A T 7: 23,835,055 N224K probably damaging Het
Vmn1r36 T A 6: 66,716,736 M52L probably benign Het
Vmn2r93 A T 17: 18,305,058 H326L possibly damaging Het
Wdr78 C T 4: 103,087,332 probably null Het
Wrn A T 8: 33,329,192 M244K probably benign Het
Zcchc24 C T 14: 25,757,154 A102T probably benign Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
R8936:Tnks UTSW 8 34853347 nonsense probably null
R9049:Tnks UTSW 8 34841778 missense probably damaging 0.96
R9080:Tnks UTSW 8 34965312 small deletion probably benign
R9182:Tnks UTSW 8 34841751 critical splice donor site probably null
R9211:Tnks UTSW 8 34849335 missense probably damaging 1.00
R9425:Tnks UTSW 8 34873665 missense probably damaging 1.00
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCAGGCAGCTAACAAGCAAGG -3'
(R):5'- AGCATAACTTGGAAGTGCCTG -3'

Sequencing Primer
(F):5'- GCAGCTAACAAGCAAGGTAAAAAC -3'
(R):5'- TCATCTGTACAGGCAAGTGTC -3'
Posted On 2021-07-15