Incidental Mutation 'R8870:2210408I21Rik'
ID676233
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8870 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77323721 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1082 (N1082Y)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: N1082Y

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: N1082Y

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,188,561 E473G probably benign Het
4930444P10Rik G A 1: 16,066,227 Q122* probably null Het
Ak8 C T 2: 28,735,590 T215M probably benign Het
Ano3 T A 2: 110,783,729 I210F probably benign Het
Atg9b A G 5: 24,387,034 F656L probably damaging Het
Bscl2 T C 19: 8,847,429 M292T probably benign Het
Cachd1 G T 4: 100,897,781 C143F probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccnb1ip1 C T 14: 50,791,993 G204E probably benign Het
Ccr1 T A 9: 123,963,985 L169F probably benign Het
Cdc42bpg A G 19: 6,314,520 N593D possibly damaging Het
Cdh20 T C 1: 104,945,323 S265P probably damaging Het
Cenpk A G 13: 104,230,857 E67G probably damaging Het
Cep76 A T 18: 67,640,120 I36K probably benign Het
Clock A T 5: 76,235,785 I507N probably benign Het
Cpne1 T C 2: 156,078,953 T110A probably benign Het
Crybg2 A T 4: 134,091,214 E1427V possibly damaging Het
Ctu1 A C 7: 43,675,322 K62Q probably damaging Het
Drd5 C A 5: 38,320,404 Q247K possibly damaging Het
Ect2l A T 10: 18,138,860 L808* probably null Het
Ficd A T 5: 113,738,187 D141V probably damaging Het
Fnbp1 A G 2: 31,048,210 Y148H Het
Gm11639 A G 11: 104,900,674 T2905A probably benign Het
Gm14409 T A 2: 177,265,519 Q62L probably benign Het
Gm49368 A G 7: 128,101,513 K485R probably benign Het
Gpr75 C A 11: 30,891,860 A255D probably benign Het
Hcrtr2 G T 9: 76,246,384 A242D probably damaging Het
Iapp G T 6: 142,298,876 V10F probably benign Het
Ikzf2 A G 1: 69,683,258 S31P possibly damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Itpkb A G 1: 180,332,179 probably benign Het
Itpr1 A G 6: 108,388,211 I874M probably damaging Het
Kif26b G T 1: 178,865,029 V512F probably damaging Het
Lhx6 G A 2: 36,105,220 probably benign Het
Lrfn1 A G 7: 28,459,493 E279G possibly damaging Het
Masp1 A C 16: 23,496,132 D126E probably damaging Het
Mef2a T C 7: 67,240,428 I299V probably benign Het
Midn A G 10: 80,150,105 S10G probably damaging Het
Mrps12 A T 7: 28,739,936 L118Q probably damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Mzf1 A G 7: 13,052,909 V78A probably benign Het
Ncoa6 A G 2: 155,421,158 V452A probably damaging Het
Neb A G 2: 52,161,469 Y6600H probably damaging Het
Nlgn2 A G 11: 69,825,471 L748P possibly damaging Het
Nnmt A T 9: 48,603,501 L72H probably damaging Het
Nrxn3 A G 12: 90,204,786 T964A probably benign Het
Olfr1277 T A 2: 111,270,119 I83F possibly damaging Het
Olfr1388 T A 11: 49,444,523 V224E probably damaging Het
Olfr197 G A 16: 59,185,767 P239S unknown Het
Olfr251 A G 9: 38,378,424 N175S probably benign Het
Olfr360 A G 2: 37,068,970 I222V probably benign Het
Olfr395 T G 11: 73,906,899 M198L probably benign Het
Olfr952 A G 9: 39,426,252 V273A probably damaging Het
Osbpl11 A G 16: 33,214,480 N280D probably benign Het
Peg10 A T 6: 4,754,825 Y202F probably damaging Het
Pick1 A G 15: 79,255,907 R469G unknown Het
Rev3l A G 10: 39,862,790 I2847V probably damaging Het
Rnaseh2b T A 14: 62,332,168 L18Q probably damaging Het
Rpl19 A G 11: 98,029,789 Y122C probably benign Het
Selp A G 1: 164,137,218 Y483C probably damaging Het
Setd2 T A 9: 110,594,253 F347L Het
Snx14 A G 9: 88,413,488 I208T probably benign Het
Spag16 T A 1: 69,996,858 F348L probably benign Het
Spata22 A T 11: 73,340,265 N115I probably damaging Het
Spata31 T C 13: 64,921,004 V322A probably benign Het
Spata5 A G 3: 37,448,512 N607D probably benign Het
Stc1 A T 14: 69,038,376 H206L probably benign Het
Tas2r129 A G 6: 132,951,559 D153G probably damaging Het
Tmem196 T A 12: 120,018,533 N167K possibly damaging Het
Tmpo T C 10: 91,151,719 T356A probably damaging Het
Tnks A G 8: 34,847,279 probably null Het
Ttbk1 A C 17: 46,470,735 L364R probably damaging Het
Vmn1r176 A T 7: 23,835,055 N224K probably damaging Het
Vmn1r36 T A 6: 66,716,736 M52L probably benign Het
Vmn2r93 A T 17: 18,305,058 H326L possibly damaging Het
Wdr78 C T 4: 103,087,332 probably null Het
Wrn A T 8: 33,329,192 M244K probably benign Het
Zcchc24 C T 14: 25,757,154 A102T probably benign Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 splice site probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 splice site probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7963:2210408I21Rik UTSW 13 77192554 missense probably benign 0.02
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
R8170:2210408I21Rik UTSW 13 77263594 missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77193159 missense possibly damaging 0.72
R8255:2210408I21Rik UTSW 13 77267731 missense possibly damaging 0.71
R8296:2210408I21Rik UTSW 13 77267777 missense probably damaging 0.98
R8476:2210408I21Rik UTSW 13 77261901 missense possibly damaging 0.92
R8526:2210408I21Rik UTSW 13 77269816 nonsense probably null
R8746:2210408I21Rik UTSW 13 77303410 missense probably benign 0.01
R8812:2210408I21Rik UTSW 13 77332352 missense probably damaging 0.98
R8885:2210408I21Rik UTSW 13 77323406 missense possibly damaging 0.91
R8910:2210408I21Rik UTSW 13 77323649 missense probably benign 0.03
R8911:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTGAAGAAAGCTGGCCTGC -3'
(R):5'- TGCTTCTCAATGGTCCTGTG -3'

Sequencing Primer
(F):5'- CTGGCCTGCTTGTCTGGAAC -3'
(R):5'- TGCTGCCCATCTGACAA -3'
Posted On2021-07-15