Incidental Mutation 'R8870:Stc1'
ID 676238
Institutional Source Beutler Lab
Gene Symbol Stc1
Ensembl Gene ENSMUSG00000014813
Gene Name stanniocalcin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock # R8870 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 69029238-69041804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69038376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 206 (H206L)
Ref Sequence ENSEMBL: ENSMUSP00000014957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014957]
AlphaFold O55183
Predicted Effect probably benign
Transcript: ENSMUST00000014957
AA Change: H206L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000014957
Gene: ENSMUSG00000014813
AA Change: H206L

DomainStartEndE-ValueType
Pfam:Stanniocalcin 6 206 1.6e-104 PFAM
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,721 N1082Y possibly damaging Het
3110002H16Rik A G 18: 12,188,561 E473G probably benign Het
4930444P10Rik G A 1: 16,066,227 Q122* probably null Het
Ak8 C T 2: 28,735,590 T215M probably benign Het
Ano3 T A 2: 110,783,729 I210F probably benign Het
Atg9b A G 5: 24,387,034 F656L probably damaging Het
Bscl2 T C 19: 8,847,429 M292T probably benign Het
Cachd1 G T 4: 100,897,781 C143F probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccnb1ip1 C T 14: 50,791,993 G204E probably benign Het
Ccr1 T A 9: 123,963,985 L169F probably benign Het
Cdc42bpg A G 19: 6,314,520 N593D possibly damaging Het
Cdh20 T C 1: 104,945,323 S265P probably damaging Het
Cenpk A G 13: 104,230,857 E67G probably damaging Het
Cep76 A T 18: 67,640,120 I36K probably benign Het
Clock A T 5: 76,235,785 I507N probably benign Het
Cpne1 T C 2: 156,078,953 T110A probably benign Het
Crybg2 A T 4: 134,091,214 E1427V possibly damaging Het
Ctu1 A C 7: 43,675,322 K62Q probably damaging Het
Drd5 C A 5: 38,320,404 Q247K possibly damaging Het
Ect2l A T 10: 18,138,860 L808* probably null Het
Ficd A T 5: 113,738,187 D141V probably damaging Het
Fnbp1 A G 2: 31,048,210 Y148H Het
Gm11639 A G 11: 104,900,674 T2905A probably benign Het
Gm14409 T A 2: 177,265,519 Q62L probably benign Het
Gm49368 A G 7: 128,101,513 K485R probably benign Het
Gpr75 C A 11: 30,891,860 A255D probably benign Het
Hcrtr2 G T 9: 76,246,384 A242D probably damaging Het
Iapp G T 6: 142,298,876 V10F probably benign Het
Ikzf2 A G 1: 69,683,258 S31P possibly damaging Het
Il18rap G A 1: 40,525,120 probably benign Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Itpkb A G 1: 180,332,179 probably benign Het
Itpr1 A G 6: 108,388,211 I874M probably damaging Het
Kif26b G T 1: 178,865,029 V512F probably damaging Het
Lhx6 G A 2: 36,105,220 probably benign Het
Lrfn1 A G 7: 28,459,493 E279G possibly damaging Het
Masp1 A C 16: 23,496,132 D126E probably damaging Het
Mef2a T C 7: 67,240,428 I299V probably benign Het
Midn A G 10: 80,150,105 S10G probably damaging Het
Mrps12 A T 7: 28,739,936 L118Q probably damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Mzf1 A G 7: 13,052,909 V78A probably benign Het
Ncoa6 A G 2: 155,421,158 V452A probably damaging Het
Neb A G 2: 52,161,469 Y6600H probably damaging Het
Nlgn2 A G 11: 69,825,471 L748P possibly damaging Het
Nnmt A T 9: 48,603,501 L72H probably damaging Het
Nrxn3 A G 12: 90,204,786 T964A probably benign Het
Olfr1277 T A 2: 111,270,119 I83F possibly damaging Het
Olfr1388 T A 11: 49,444,523 V224E probably damaging Het
Olfr197 G A 16: 59,185,767 P239S unknown Het
Olfr251 A G 9: 38,378,424 N175S probably benign Het
Olfr360 A G 2: 37,068,970 I222V probably benign Het
Olfr395 T G 11: 73,906,899 M198L probably benign Het
Olfr952 A G 9: 39,426,252 V273A probably damaging Het
Osbpl11 A G 16: 33,214,480 N280D probably benign Het
Peg10 A T 6: 4,754,825 Y202F probably damaging Het
Pick1 A G 15: 79,255,907 R469G unknown Het
Rev3l A G 10: 39,862,790 I2847V probably damaging Het
Rnaseh2b T A 14: 62,332,168 L18Q probably damaging Het
Rpl19 A G 11: 98,029,789 Y122C probably benign Het
Selp A G 1: 164,137,218 Y483C probably damaging Het
Setd2 T A 9: 110,594,253 F347L Het
Snx14 A G 9: 88,413,488 I208T probably benign Het
Spag16 T A 1: 69,996,858 F348L probably benign Het
Spata22 A T 11: 73,340,265 N115I probably damaging Het
Spata31 T C 13: 64,921,004 V322A probably benign Het
Spata5 A G 3: 37,448,512 N607D probably benign Het
Tas2r129 A G 6: 132,951,559 D153G probably damaging Het
Tmem196 T A 12: 120,018,533 N167K possibly damaging Het
Tmpo T C 10: 91,151,719 T356A probably damaging Het
Tnks A G 8: 34,847,279 probably null Het
Ttbk1 A C 17: 46,470,735 L364R probably damaging Het
Vmn1r176 A T 7: 23,835,055 N224K probably damaging Het
Vmn1r36 T A 6: 66,716,736 M52L probably benign Het
Vmn2r93 A T 17: 18,305,058 H326L possibly damaging Het
Wdr78 C T 4: 103,087,332 probably null Het
Wrn A T 8: 33,329,192 M244K probably benign Het
Zcchc24 C T 14: 25,757,154 A102T probably benign Het
Other mutations in Stc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Stc1 APN 14 69038277 missense probably benign 0.21
IGL01918:Stc1 APN 14 69031654 splice site probably benign
R0318:Stc1 UTSW 14 69038418 missense probably damaging 0.98
R0322:Stc1 UTSW 14 69029409 missense probably benign 0.08
R1699:Stc1 UTSW 14 69038327 missense probably benign 0.00
R2005:Stc1 UTSW 14 69031647 critical splice donor site probably null
R3801:Stc1 UTSW 14 69038475 missense probably benign
R3803:Stc1 UTSW 14 69038475 missense probably benign
R4184:Stc1 UTSW 14 69029385 start gained probably benign
R5206:Stc1 UTSW 14 69031599 missense probably damaging 1.00
R5927:Stc1 UTSW 14 69032373 missense probably benign 0.02
R6059:Stc1 UTSW 14 69032438 missense probably damaging 1.00
R6185:Stc1 UTSW 14 69038364 missense probably damaging 1.00
R7722:Stc1 UTSW 14 69032280 missense possibly damaging 0.76
R8001:Stc1 UTSW 14 69038395 missense probably benign 0.34
R8944:Stc1 UTSW 14 69032435 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TTGGTGTCTGAACCTGCTCC -3'
(R):5'- ACACTCAAAGTTGGTGTGTCAAC -3'

Sequencing Primer
(F):5'- GAACCTGCTCCTGCCTTTG -3'
(R):5'- CACCCCTAAAATGCTATTAGTTTGG -3'
Posted On 2021-07-15