Incidental Mutation 'R8872:Slc30a7'
ID 676342
Institutional Source Beutler Lab
Gene Symbol Slc30a7
Ensembl Gene ENSMUSG00000054414
Gene Name solute carrier family 30 (zinc transporter), member 7
Synonyms 2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock # R8872 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 115938973-116007406 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115946668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 378 (M378K)
Ref Sequence ENSEMBL: ENSMUSP00000065254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067485]
AlphaFold Q9JKN1
Predicted Effect possibly damaging
Transcript: ENSMUST00000067485
AA Change: M378K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414
AA Change: M378K

DomainStartEndE-ValueType
Pfam:Cation_efflux 38 296 3.3e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,644 S150G possibly damaging Het
4932415D10Rik A T 10: 82,292,785 S1464T probably benign Het
Alpk2 A T 18: 65,280,906 S1579R probably damaging Het
Ank2 C T 3: 126,997,876 E814K possibly damaging Het
Cep57 A G 9: 13,826,684 probably benign Het
Cntnap4 A T 8: 112,859,127 R1127S possibly damaging Het
Comt C A 16: 18,426,489 probably benign Het
Crlf3 T C 11: 80,047,614 N399S Het
Crls1 T A 2: 132,849,899 S115T probably benign Het
Dixdc1 A G 9: 50,703,153 S199P possibly damaging Het
Dsc3 T C 18: 19,989,622 T82A probably benign Het
Exosc6 T A 8: 111,057,152 V261E probably damaging Het
Fbxw17 C T 13: 50,432,264 S361L probably benign Het
Gfap T A 11: 102,895,794 N157Y possibly damaging Het
Gigyf2 A T 1: 87,380,003 D177V unknown Het
Gls2 A T 10: 128,204,666 Q312L probably benign Het
Gm11639 T G 11: 104,870,054 L2411R probably benign Het
Gm8909 T A 17: 36,165,401 I324F probably benign Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l A T 18: 10,529,684 M889L probably benign Het
Gucy1a1 T A 3: 82,108,742 D313V probably damaging Het
Herpud1 C T 8: 94,386,585 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il27 A C 7: 126,591,022 L140R probably damaging Het
Jarid2 T C 13: 44,902,508 S397P possibly damaging Het
Kdm5a A C 6: 120,388,140 D334A probably damaging Het
Lman2 T C 13: 55,348,384 T283A probably benign Het
Lrfn2 C T 17: 49,071,249 Q453* probably null Het
Lrrfip2 A G 9: 111,205,756 E171G possibly damaging Het
Mboat1 T A 13: 30,226,414 Y285N probably damaging Het
Med15 C A 16: 17,652,741 S734I probably damaging Het
Mgat4c T A 10: 102,388,285 I120N probably damaging Het
Ms4a4d T C 19: 11,552,887 M104T possibly damaging Het
Mtf2 A T 5: 108,099,185 M330L probably benign Het
Myoc T C 1: 162,647,444 V188A probably benign Het
Nos2 T A 11: 78,949,123 I686N probably damaging Het
Npffr1 T C 10: 61,626,015 V310A probably benign Het
Nrap T C 19: 56,320,195 *1729W probably null Het
Odam A G 5: 87,887,938 probably null Het
Olfm4 G T 14: 80,021,503 R397L probably damaging Het
Olfr406 T G 11: 74,269,294 probably benign Het
Polr1b T C 2: 129,115,693 V556A probably damaging Het
Prl3d3 A G 13: 27,162,341 D186G possibly damaging Het
Psmc5 C A 11: 106,261,920 Y189* probably null Het
Rasgrp4 A G 7: 29,139,096 Y123C possibly damaging Het
Rtn4 A G 11: 29,708,633 E929G probably benign Het
Scrn2 A T 11: 97,032,135 I135F probably damaging Het
Sec24d T A 3: 123,354,936 probably benign Het
Secisbp2l T C 2: 125,752,972 T523A probably benign Het
Slain1 T A 14: 103,688,405 probably null Het
Slc22a29 A G 19: 8,160,567 V548A probably damaging Het
Slc25a32 T C 15: 39,105,944 I65V probably benign Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Spdye4b G T 5: 143,202,060 K156N probably damaging Het
Sptb A G 12: 76,612,039 Y1241H probably benign Het
Ssu2 G A 6: 112,380,995 T129I probably damaging Het
Supt16 A G 14: 52,174,087 V613A probably benign Het
Sycp3 A T 10: 88,466,526 E126V probably damaging Het
Tatdn2 A T 6: 113,704,209 Y401F probably damaging Het
Tigd4 T C 3: 84,594,240 S155P probably benign Het
Tnrc6b A G 15: 80,918,089 N1502S probably benign Het
Ttc37 T C 13: 76,185,207 L1525P probably damaging Het
Ttf2 A G 3: 100,963,328 V143A probably benign Het
Ttn T A 2: 76,788,403 D16179V probably damaging Het
Vmn2r106 A T 17: 20,268,139 M666K probably benign Het
Vwa5b1 A T 4: 138,578,645 V914D probably damaging Het
Wnk2 T C 13: 49,057,484 M1632V probably benign Het
Zbtb26 T A 2: 37,436,901 N41I probably damaging Het
Zc3h12a T C 4: 125,126,619 N144D probably damaging Het
Zfp266 A T 9: 20,499,979 C301S probably benign Het
Zfp580 A G 7: 5,053,217 H192R possibly damaging Het
Zfp748 A G 13: 67,541,795 C449R probably damaging Het
Zp2 T C 7: 120,133,802 I612V probably benign Het
Other mutations in Slc30a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Slc30a7 APN 3 115946720 splice site probably null
IGL01161:Slc30a7 APN 3 115954110 missense possibly damaging 0.54
IGL01360:Slc30a7 APN 3 115990116 missense probably damaging 1.00
IGL02573:Slc30a7 APN 3 115990147 splice site probably benign
R0833:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R0836:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R1381:Slc30a7 UTSW 3 115956870 critical splice donor site probably null
R2445:Slc30a7 UTSW 3 115978653 missense probably damaging 1.00
R4072:Slc30a7 UTSW 3 115946680 missense probably damaging 0.96
R4850:Slc30a7 UTSW 3 115993008 missense probably damaging 0.99
R5429:Slc30a7 UTSW 3 116006925 missense possibly damaging 0.90
R5586:Slc30a7 UTSW 3 115990051 missense probably benign 0.36
R6170:Slc30a7 UTSW 3 115990743 missense probably damaging 1.00
R6813:Slc30a7 UTSW 3 115981811 missense probably benign 0.01
R6889:Slc30a7 UTSW 3 115954153 missense probably damaging 1.00
R8445:Slc30a7 UTSW 3 116007346 unclassified probably benign
X0023:Slc30a7 UTSW 3 115990025 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGCAGTCAGAATGGCTTG -3'
(R):5'- TCCTGTAGTAGTTTGACGACTTAC -3'

Sequencing Primer
(F):5'- AGCAGTCTGGGCAGGATC -3'
(R):5'- GTTTGACGACTTACAATGAAAATGG -3'
Posted On 2021-07-15