Mutagenetix > Incidental Mutations

Incidental Mutation 'R8872:Tnrc6b'

676388

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R8872 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80918089 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1502 (N1502S)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably benign
Transcript: ENSMUST00000067689
AA Change: N1502S

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: N1502S

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

Meta Mutation Damage Score

0.0617

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	A	G	17: 48,090,644	S150G	possibly damaging	Het
4932415D10Rik	A	T	10: 82,292,785	S1464T	probably benign	Het
Alpk2	A	T	18: 65,280,906	S1579R	probably damaging	Het
Ank2	C	T	3: 126,997,876	E814K	possibly damaging	Het
Cep57	A	G	9: 13,826,684		probably benign	Het
Cntnap4	A	T	8: 112,859,127	R1127S	possibly damaging	Het
Comt	C	A	16: 18,426,489		probably benign	Het
Crlf3	T	C	11: 80,047,614	N399S		Het
Crls1	T	A	2: 132,849,899	S115T	probably benign	Het
Dixdc1	A	G	9: 50,703,153	S199P	possibly damaging	Het
Dsc3	T	C	18: 19,989,622	T82A	probably benign	Het
Exosc6	T	A	8: 111,057,152	V261E	probably damaging	Het
Fbxw17	C	T	13: 50,432,264	S361L	probably benign	Het
Gfap	T	A	11: 102,895,794	N157Y	possibly damaging	Het
Gigyf2	A	T	1: 87,380,003	D177V	unknown	Het
Gls2	A	T	10: 128,204,666	Q312L	probably benign	Het
Gm11639	T	G	11: 104,870,054	L2411R	probably benign	Het
Gm8909	T	A	17: 36,165,401	I324F	probably benign	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Greb1l	A	T	18: 10,529,684	M889L	probably benign	Het
Gucy1a1	T	A	3: 82,108,742	D313V	probably damaging	Het
Herpud1	C	T	8: 94,386,585		probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Il27	A	C	7: 126,591,022	L140R	probably damaging	Het
Jarid2	T	C	13: 44,902,508	S397P	possibly damaging	Het
Kdm5a	A	C	6: 120,388,140	D334A	probably damaging	Het
Lman2	T	C	13: 55,348,384	T283A	probably benign	Het
Lrfn2	C	T	17: 49,071,249	Q453*	probably null	Het
Lrrfip2	A	G	9: 111,205,756	E171G	possibly damaging	Het
Mboat1	T	A	13: 30,226,414	Y285N	probably damaging	Het
Med15	C	A	16: 17,652,741	S734I	probably damaging	Het
Mgat4c	T	A	10: 102,388,285	I120N	probably damaging	Het
Ms4a4d	T	C	19: 11,552,887	M104T	possibly damaging	Het
Mtf2	A	T	5: 108,099,185	M330L	probably benign	Het
Myoc	T	C	1: 162,647,444	V188A	probably benign	Het
Nos2	T	A	11: 78,949,123	I686N	probably damaging	Het
Npffr1	T	C	10: 61,626,015	V310A	probably benign	Het
Nrap	T	C	19: 56,320,195	*1729W	probably null	Het
Odam	A	G	5: 87,887,938		probably null	Het
Olfm4	G	T	14: 80,021,503	R397L	probably damaging	Het
Olfr406	T	G	11: 74,269,294		probably benign	Het
Polr1b	T	C	2: 129,115,693	V556A	probably damaging	Het
Prl3d3	A	G	13: 27,162,341	D186G	possibly damaging	Het
Psmc5	C	A	11: 106,261,920	Y189*	probably null	Het
Rasgrp4	A	G	7: 29,139,096	Y123C	possibly damaging	Het
Rtn4	A	G	11: 29,708,633	E929G	probably benign	Het
Scrn2	A	T	11: 97,032,135	I135F	probably damaging	Het
Sec24d	T	A	3: 123,354,936		probably benign	Het
Secisbp2l	T	C	2: 125,752,972	T523A	probably benign	Het
Slain1	T	A	14: 103,688,405		probably null	Het
Slc22a29	A	G	19: 8,160,567	V548A	probably damaging	Het
Slc25a32	T	C	15: 39,105,944	I65V	probably benign	Het
Slc30a7	A	T	3: 115,946,668	M378K	possibly damaging	Het
Smarcd1	T	A	15: 99,711,094	I383N	probably damaging	Het
Spdye4b	G	T	5: 143,202,060	K156N	probably damaging	Het
Sptb	A	G	12: 76,612,039	Y1241H	probably benign	Het
Ssu2	G	A	6: 112,380,995	T129I	probably damaging	Het
Supt16	A	G	14: 52,174,087	V613A	probably benign	Het
Sycp3	A	T	10: 88,466,526	E126V	probably damaging	Het
Tatdn2	A	T	6: 113,704,209	Y401F	probably damaging	Het
Tigd4	T	C	3: 84,594,240	S155P	probably benign	Het
Ttc37	T	C	13: 76,185,207	L1525P	probably damaging	Het
Ttf2	A	G	3: 100,963,328	V143A	probably benign	Het
Ttn	T	A	2: 76,788,403	D16179V	probably damaging	Het
Vmn2r106	A	T	17: 20,268,139	M666K	probably benign	Het
Vwa5b1	A	T	4: 138,578,645	V914D	probably damaging	Het
Wnk2	T	C	13: 49,057,484	M1632V	probably benign	Het
Zbtb26	T	A	2: 37,436,901	N41I	probably damaging	Het
Zc3h12a	T	C	4: 125,126,619	N144D	probably damaging	Het
Zfp266	A	T	9: 20,499,979	C301S	probably benign	Het
Zfp580	A	G	7: 5,053,217	H192R	possibly damaging	Het
Zfp748	A	G	13: 67,541,795	C449R	probably damaging	Het
Zp2	T	C	7: 120,133,802	I612V	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ACTGACAAGAGTGTTTGTTCATGG -3'
(R):5'- TGTTGAGGGAGGAATTAGACCC -3'

Sequencing Primer
(F):5'- CGTGATGAAAATCTGATGCATAGTAG -3'
(R):5'- CCACAGGCGAATAACTATG -3'

Posted On

2021-07-15