Incidental Mutation 'R8872:Tnrc6b'
ID 676388
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R8872 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80918089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1502 (N1502S)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect probably benign
Transcript: ENSMUST00000067689
AA Change: N1502S

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: N1502S

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,644 S150G possibly damaging Het
4932415D10Rik A T 10: 82,292,785 S1464T probably benign Het
Alpk2 A T 18: 65,280,906 S1579R probably damaging Het
Ank2 C T 3: 126,997,876 E814K possibly damaging Het
Cep57 A G 9: 13,826,684 probably benign Het
Cntnap4 A T 8: 112,859,127 R1127S possibly damaging Het
Comt C A 16: 18,426,489 probably benign Het
Crlf3 T C 11: 80,047,614 N399S Het
Crls1 T A 2: 132,849,899 S115T probably benign Het
Dixdc1 A G 9: 50,703,153 S199P possibly damaging Het
Dsc3 T C 18: 19,989,622 T82A probably benign Het
Exosc6 T A 8: 111,057,152 V261E probably damaging Het
Fbxw17 C T 13: 50,432,264 S361L probably benign Het
Gfap T A 11: 102,895,794 N157Y possibly damaging Het
Gigyf2 A T 1: 87,380,003 D177V unknown Het
Gls2 A T 10: 128,204,666 Q312L probably benign Het
Gm11639 T G 11: 104,870,054 L2411R probably benign Het
Gm8909 T A 17: 36,165,401 I324F probably benign Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l A T 18: 10,529,684 M889L probably benign Het
Gucy1a1 T A 3: 82,108,742 D313V probably damaging Het
Herpud1 C T 8: 94,386,585 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il27 A C 7: 126,591,022 L140R probably damaging Het
Jarid2 T C 13: 44,902,508 S397P possibly damaging Het
Kdm5a A C 6: 120,388,140 D334A probably damaging Het
Lman2 T C 13: 55,348,384 T283A probably benign Het
Lrfn2 C T 17: 49,071,249 Q453* probably null Het
Lrrfip2 A G 9: 111,205,756 E171G possibly damaging Het
Mboat1 T A 13: 30,226,414 Y285N probably damaging Het
Med15 C A 16: 17,652,741 S734I probably damaging Het
Mgat4c T A 10: 102,388,285 I120N probably damaging Het
Ms4a4d T C 19: 11,552,887 M104T possibly damaging Het
Mtf2 A T 5: 108,099,185 M330L probably benign Het
Myoc T C 1: 162,647,444 V188A probably benign Het
Nos2 T A 11: 78,949,123 I686N probably damaging Het
Npffr1 T C 10: 61,626,015 V310A probably benign Het
Nrap T C 19: 56,320,195 *1729W probably null Het
Odam A G 5: 87,887,938 probably null Het
Olfm4 G T 14: 80,021,503 R397L probably damaging Het
Olfr406 T G 11: 74,269,294 probably benign Het
Polr1b T C 2: 129,115,693 V556A probably damaging Het
Prl3d3 A G 13: 27,162,341 D186G possibly damaging Het
Psmc5 C A 11: 106,261,920 Y189* probably null Het
Rasgrp4 A G 7: 29,139,096 Y123C possibly damaging Het
Rtn4 A G 11: 29,708,633 E929G probably benign Het
Scrn2 A T 11: 97,032,135 I135F probably damaging Het
Sec24d T A 3: 123,354,936 probably benign Het
Secisbp2l T C 2: 125,752,972 T523A probably benign Het
Slain1 T A 14: 103,688,405 probably null Het
Slc22a29 A G 19: 8,160,567 V548A probably damaging Het
Slc25a32 T C 15: 39,105,944 I65V probably benign Het
Slc30a7 A T 3: 115,946,668 M378K possibly damaging Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Spdye4b G T 5: 143,202,060 K156N probably damaging Het
Sptb A G 12: 76,612,039 Y1241H probably benign Het
Ssu2 G A 6: 112,380,995 T129I probably damaging Het
Supt16 A G 14: 52,174,087 V613A probably benign Het
Sycp3 A T 10: 88,466,526 E126V probably damaging Het
Tatdn2 A T 6: 113,704,209 Y401F probably damaging Het
Tigd4 T C 3: 84,594,240 S155P probably benign Het
Ttc37 T C 13: 76,185,207 L1525P probably damaging Het
Ttf2 A G 3: 100,963,328 V143A probably benign Het
Ttn T A 2: 76,788,403 D16179V probably damaging Het
Vmn2r106 A T 17: 20,268,139 M666K probably benign Het
Vwa5b1 A T 4: 138,578,645 V914D probably damaging Het
Wnk2 T C 13: 49,057,484 M1632V probably benign Het
Zbtb26 T A 2: 37,436,901 N41I probably damaging Het
Zc3h12a T C 4: 125,126,619 N144D probably damaging Het
Zfp266 A T 9: 20,499,979 C301S probably benign Het
Zfp580 A G 7: 5,053,217 H192R possibly damaging Het
Zfp748 A G 13: 67,541,795 C449R probably damaging Het
Zp2 T C 7: 120,133,802 I612V probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
R9029:Tnrc6b UTSW 15 80878978 missense possibly damaging 0.83
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9240:Tnrc6b UTSW 15 80880061 missense probably damaging 0.98
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACTGACAAGAGTGTTTGTTCATGG -3'
(R):5'- TGTTGAGGGAGGAATTAGACCC -3'

Sequencing Primer
(F):5'- CGTGATGAAAATCTGATGCATAGTAG -3'
(R):5'- CCACAGGCGAATAACTATG -3'
Posted On 2021-07-15