Incidental Mutation 'R8872:Greb1l'
ID676396
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8872 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10529684 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 889 (M889L)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: M889L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: M889L

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: M780L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: M780L

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,644 S150G possibly damaging Het
4932415D10Rik A T 10: 82,292,785 S1464T probably benign Het
Alpk2 A T 18: 65,280,906 S1579R probably damaging Het
Ank2 C T 3: 126,997,876 E814K possibly damaging Het
Cntnap4 A T 8: 112,859,127 R1127S possibly damaging Het
Comt C A 16: 18,426,489 probably benign Het
Crlf3 T C 11: 80,047,614 N399S Het
Crls1 T A 2: 132,849,899 S115T probably benign Het
Dixdc1 A G 9: 50,703,153 S199P possibly damaging Het
Dsc3 T C 18: 19,989,622 T82A probably benign Het
Exosc6 T A 8: 111,057,152 V261E probably damaging Het
Fbxw17 C T 13: 50,432,264 S361L probably benign Het
Gfap T A 11: 102,895,794 N157Y possibly damaging Het
Gigyf2 A T 1: 87,380,003 D177V unknown Het
Gls2 A T 10: 128,204,666 Q312L probably benign Het
Gm11639 T G 11: 104,870,054 L2411R probably benign Het
Gm8909 T A 17: 36,165,401 I324F probably benign Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Gucy1a1 T A 3: 82,108,742 D313V probably damaging Het
Herpud1 C T 8: 94,386,585 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il27 A C 7: 126,591,022 L140R probably damaging Het
Jarid2 T C 13: 44,902,508 S397P possibly damaging Het
Kdm5a A C 6: 120,388,140 D334A probably damaging Het
Lman2 T C 13: 55,348,384 T283A probably benign Het
Lrfn2 C T 17: 49,071,249 Q453* probably null Het
Lrrfip2 A G 9: 111,205,756 E171G possibly damaging Het
Mboat1 T A 13: 30,226,414 Y285N probably damaging Het
Med15 C A 16: 17,652,741 S734I probably damaging Het
Mgat4c T A 10: 102,388,285 I120N probably damaging Het
Ms4a4d T C 19: 11,552,887 M104T possibly damaging Het
Mtf2 A T 5: 108,099,185 M330L probably benign Het
Myoc T C 1: 162,647,444 V188A probably benign Het
Nos2 T A 11: 78,949,123 I686N probably damaging Het
Npffr1 T C 10: 61,626,015 V310A probably benign Het
Nrap T C 19: 56,320,195 *1729W probably null Het
Odam A G 5: 87,887,938 probably null Het
Olfm4 G T 14: 80,021,503 R397L probably damaging Het
Polr1b T C 2: 129,115,693 V556A probably damaging Het
Prl3d3 A G 13: 27,162,341 D186G possibly damaging Het
Psmc5 C A 11: 106,261,920 Y189* probably null Het
Rasgrp4 A G 7: 29,139,096 Y123C possibly damaging Het
Rtn4 A G 11: 29,708,633 E929G probably benign Het
Scrn2 A T 11: 97,032,135 I135F probably damaging Het
Secisbp2l T C 2: 125,752,972 T523A probably benign Het
Slain1 T A 14: 103,688,405 probably null Het
Slc22a29 A G 19: 8,160,567 V548A probably damaging Het
Slc25a32 T C 15: 39,105,944 I65V probably benign Het
Slc30a7 A T 3: 115,946,668 M378K possibly damaging Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Spdye4b G T 5: 143,202,060 K156N probably damaging Het
Sptb A G 12: 76,612,039 Y1241H probably benign Het
Ssu2 G A 6: 112,380,995 T129I probably damaging Het
Supt16 A G 14: 52,174,087 V613A probably benign Het
Sycp3 A T 10: 88,466,526 E126V probably damaging Het
Tatdn2 A T 6: 113,704,209 Y401F probably damaging Het
Tigd4 T C 3: 84,594,240 S155P probably benign Het
Tnrc6b A G 15: 80,918,089 N1502S probably benign Het
Ttc37 T C 13: 76,185,207 L1525P probably damaging Het
Ttf2 A G 3: 100,963,328 V143A probably benign Het
Ttn T A 2: 76,788,403 D16179V probably damaging Het
Vmn2r106 A T 17: 20,268,139 M666K probably benign Het
Vwa5b1 A T 4: 138,578,645 V914D probably damaging Het
Wnk2 T C 13: 49,057,484 M1632V probably benign Het
Zbtb26 T A 2: 37,436,901 N41I probably damaging Het
Zc3h12a T C 4: 125,126,619 N144D probably damaging Het
Zfp266 A T 9: 20,499,979 C301S probably benign Het
Zfp580 A G 7: 5,053,217 H192R possibly damaging Het
Zfp748 A G 13: 67,541,795 C449R probably damaging Het
Zp2 T C 7: 120,133,802 I612V probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGTTCCACGAAAATACAGTAC -3'
(R):5'- TAGGAGAAGGCCACCTTGAG -3'

Sequencing Primer
(F):5'- ACTGGTGTCAAGTTCACAGC -3'
(R):5'- TGTGAAATGGCCAGACAG -3'
Posted On2021-07-15