Incidental Mutation 'R8872:Alpk2'
ID676398
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8872 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65280906 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1579 (S1579R)
Ref Sequence ENSEMBL: ENSMUSP00000114658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: S2046R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: S2046R

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141250
AA Change: S1579R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: S1579R

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,644 S150G possibly damaging Het
4932415D10Rik A T 10: 82,292,785 S1464T probably benign Het
Ank2 C T 3: 126,997,876 E814K possibly damaging Het
Cntnap4 A T 8: 112,859,127 R1127S possibly damaging Het
Comt C A 16: 18,426,489 probably benign Het
Crlf3 T C 11: 80,047,614 N399S Het
Crls1 T A 2: 132,849,899 S115T probably benign Het
Dixdc1 A G 9: 50,703,153 S199P possibly damaging Het
Dsc3 T C 18: 19,989,622 T82A probably benign Het
Exosc6 T A 8: 111,057,152 V261E probably damaging Het
Fbxw17 C T 13: 50,432,264 S361L probably benign Het
Gfap T A 11: 102,895,794 N157Y possibly damaging Het
Gigyf2 A T 1: 87,380,003 D177V unknown Het
Gls2 A T 10: 128,204,666 Q312L probably benign Het
Gm11639 T G 11: 104,870,054 L2411R probably benign Het
Gm8909 T A 17: 36,165,401 I324F probably benign Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l A T 18: 10,529,684 M889L probably benign Het
Gucy1a1 T A 3: 82,108,742 D313V probably damaging Het
Herpud1 C T 8: 94,386,585 probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il27 A C 7: 126,591,022 L140R probably damaging Het
Jarid2 T C 13: 44,902,508 S397P possibly damaging Het
Kdm5a A C 6: 120,388,140 D334A probably damaging Het
Lman2 T C 13: 55,348,384 T283A probably benign Het
Lrfn2 C T 17: 49,071,249 Q453* probably null Het
Lrrfip2 A G 9: 111,205,756 E171G possibly damaging Het
Mboat1 T A 13: 30,226,414 Y285N probably damaging Het
Med15 C A 16: 17,652,741 S734I probably damaging Het
Mgat4c T A 10: 102,388,285 I120N probably damaging Het
Ms4a4d T C 19: 11,552,887 M104T possibly damaging Het
Mtf2 A T 5: 108,099,185 M330L probably benign Het
Myoc T C 1: 162,647,444 V188A probably benign Het
Nos2 T A 11: 78,949,123 I686N probably damaging Het
Npffr1 T C 10: 61,626,015 V310A probably benign Het
Nrap T C 19: 56,320,195 *1729W probably null Het
Odam A G 5: 87,887,938 probably null Het
Olfm4 G T 14: 80,021,503 R397L probably damaging Het
Polr1b T C 2: 129,115,693 V556A probably damaging Het
Prl3d3 A G 13: 27,162,341 D186G possibly damaging Het
Psmc5 C A 11: 106,261,920 Y189* probably null Het
Rasgrp4 A G 7: 29,139,096 Y123C possibly damaging Het
Rtn4 A G 11: 29,708,633 E929G probably benign Het
Scrn2 A T 11: 97,032,135 I135F probably damaging Het
Secisbp2l T C 2: 125,752,972 T523A probably benign Het
Slain1 T A 14: 103,688,405 probably null Het
Slc22a29 A G 19: 8,160,567 V548A probably damaging Het
Slc25a32 T C 15: 39,105,944 I65V probably benign Het
Slc30a7 A T 3: 115,946,668 M378K possibly damaging Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Spdye4b G T 5: 143,202,060 K156N probably damaging Het
Sptb A G 12: 76,612,039 Y1241H probably benign Het
Ssu2 G A 6: 112,380,995 T129I probably damaging Het
Supt16 A G 14: 52,174,087 V613A probably benign Het
Sycp3 A T 10: 88,466,526 E126V probably damaging Het
Tatdn2 A T 6: 113,704,209 Y401F probably damaging Het
Tigd4 T C 3: 84,594,240 S155P probably benign Het
Tnrc6b A G 15: 80,918,089 N1502S probably benign Het
Ttc37 T C 13: 76,185,207 L1525P probably damaging Het
Ttf2 A G 3: 100,963,328 V143A probably benign Het
Ttn T A 2: 76,788,403 D16179V probably damaging Het
Vmn2r106 A T 17: 20,268,139 M666K probably benign Het
Vwa5b1 A T 4: 138,578,645 V914D probably damaging Het
Wnk2 T C 13: 49,057,484 M1632V probably benign Het
Zbtb26 T A 2: 37,436,901 N41I probably damaging Het
Zc3h12a T C 4: 125,126,619 N144D probably damaging Het
Zfp266 A T 9: 20,499,979 C301S probably benign Het
Zfp580 A G 7: 5,053,217 H192R possibly damaging Het
Zfp748 A G 13: 67,541,795 C449R probably damaging Het
Zp2 T C 7: 120,133,802 I612V probably benign Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R7953:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
R8171:Alpk2 UTSW 18 65305983 missense probably benign 0.00
R8280:Alpk2 UTSW 18 65307203 missense probably benign
R8383:Alpk2 UTSW 18 65305398 missense probably benign 0.03
R8414:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
R8791:Alpk2 UTSW 18 65305526 missense probably benign 0.00
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGACATTTCCTAGAGGTCAGCC -3'
(R):5'- TTATCCATCGGCCCGAGAAC -3'

Sequencing Primer
(F):5'- CCCAAGCTTCATTTGTAATGGGAC -3'
(R):5'- CAACATCCCATATGCCACAGTGG -3'
Posted On2021-07-15