Incidental Mutation 'R8873:Dock4'
ID 676426
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 068686-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R8873 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 40726767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 348 (Y348*)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably null
Transcript: ENSMUST00000037488
AA Change: Y348*
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: Y348*

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000220912
AA Change: Y348*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C A 11: 77,406,577 (GRCm39) R185S probably damaging Het
Aoah A G 13: 21,089,852 (GRCm39) N157D probably benign Het
Arhgap35 T C 7: 16,295,415 (GRCm39) N1217D possibly damaging Het
Asah2 A T 19: 32,022,288 (GRCm39) probably null Het
Asb2 T C 12: 103,299,725 (GRCm39) N236D probably damaging Het
Auts2 A G 5: 131,472,502 (GRCm39) F317L Het
Cfap74 T C 4: 155,539,465 (GRCm39) I930T unknown Het
Cmip T C 8: 118,103,929 (GRCm39) V51A probably damaging Het
Col15a1 T C 4: 47,247,552 (GRCm39) probably null Het
Cstf3 A T 2: 104,475,355 (GRCm39) H97L possibly damaging Het
Dip2c A T 13: 9,625,182 (GRCm39) M559L probably benign Het
Dnah5 A G 15: 28,219,334 (GRCm39) N51D probably benign Het
Ehhadh C T 16: 21,581,598 (GRCm39) G465R probably damaging Het
Fam110b C T 4: 5,799,103 (GRCm39) Q174* probably null Het
Fam124a A G 14: 62,844,024 (GRCm39) T511A probably benign Het
Fbxl17 A G 17: 63,691,971 (GRCm39) V528A probably damaging Het
Fbxw24 C A 9: 109,453,996 (GRCm39) W50L probably damaging Het
Fyb2 A T 4: 104,856,538 (GRCm39) E582V probably damaging Het
Ganab G A 19: 8,888,243 (GRCm39) W463* probably null Het
Gm11569 G T 11: 99,689,210 (GRCm39) T163N unknown Het
Gm8237 G T 14: 5,862,453 (GRCm38) Y86* probably null Het
Hrh4 T A 18: 13,140,195 (GRCm39) M30K Het
Ifi209 A G 1: 173,470,156 (GRCm39) Y248C probably damaging Het
Jazf1 T A 6: 52,789,165 (GRCm39) H103L probably damaging Het
Ltbp1 A G 17: 75,486,172 (GRCm39) T66A probably damaging Het
Ndufa4 A G 6: 11,907,360 (GRCm39) L2P probably benign Het
Npnt G A 3: 132,655,816 (GRCm39) probably benign Het
Nrxn1 G T 17: 90,872,821 (GRCm39) C1052* probably null Het
Nsmce4a G T 7: 130,148,886 (GRCm39) A40E unknown Het
Or2t6 A T 14: 14,175,344 (GRCm38) V246E probably damaging Het
Pcdhgb2 T C 18: 37,824,341 (GRCm39) V444A probably damaging Het
Pcdhgb7 C T 18: 37,886,575 (GRCm39) P582S possibly damaging Het
Phf3 T C 1: 30,843,773 (GRCm39) T1729A possibly damaging Het
Plod2 T A 9: 92,489,112 (GRCm39) probably benign Het
Pramel15 G T 4: 144,099,871 (GRCm39) A298E probably benign Het
Rbm20 G T 19: 53,665,911 (GRCm39) V25F probably benign Het
Recql G T 6: 142,308,013 (GRCm39) Q53K Het
Rps18-ps6 T A 13: 97,896,843 (GRCm39) N85I probably damaging Het
Rtel1 CAAA CAA 2: 180,997,816 (GRCm39) probably null Het
Serpine2 A G 1: 79,799,267 (GRCm39) probably benign Het
Siglecg A G 7: 43,067,448 (GRCm39) T672A probably benign Het
Skil T C 3: 31,152,075 (GRCm39) L199P probably damaging Het
Tmprss11f C T 5: 86,692,733 (GRCm39) A64T probably damaging Het
Ttc3 C T 16: 94,243,842 (GRCm39) T1282M probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATTCCTGCCCACACTAAGTAAG -3'
(R):5'- GCCTACCACCATTTAGGGAAG -3'

Sequencing Primer
(F):5'- TGCCCACACTAAGTAAGCCTCATG -3'
(R):5'- CTACCACCATTTAGGGAAGTGCTG -3'
Posted On 2021-07-15