Incidental Mutation 'R0732:A2ml1'
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
MMRRC Submission 038913-MU
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0732 (G1)
Quality Score225
Status Not validated
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128546448 bp
Amino Acid Change Tyrosine to Cysteine at position 1175 (Y1175C)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably damaging
Transcript: ENSMUST00000060574
AA Change: Y1175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: Y1175C

low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205167
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T C 7: 119,773,834 S187P probably benign Het
Adam28 T C 14: 68,637,347 I294V probably benign Het
Adgrv1 T C 13: 81,503,004 I3057M possibly damaging Het
Aff4 T C 11: 53,375,596 V304A probably benign Het
Akr1b10 T C 6: 34,390,109 Y108H probably benign Het
Ankib1 T C 5: 3,713,163 N522S possibly damaging Het
Ano1 T A 7: 144,619,488 probably null Het
Antxr2 G T 5: 97,960,708 probably null Het
Arc G A 15: 74,671,195 T393I probably damaging Het
Arhgef33 A G 17: 80,381,354 D5G possibly damaging Het
Atf2 A T 2: 73,845,500 M169K possibly damaging Het
BC005624 T A 2: 30,973,937 T215S possibly damaging Het
BC048403 T C 10: 121,750,947 V253A possibly damaging Het
Bmp8b G A 4: 123,105,406 G19D unknown Het
Cacna1d T C 14: 30,042,920 N1987S probably damaging Het
Camta1 T A 4: 151,586,484 probably null Het
Catsperg2 C T 7: 29,700,696 G316D probably damaging Het
Cbs G T 17: 31,625,029 N209K probably benign Het
Ccdc122 T A 14: 77,091,759 M84K probably damaging Het
Cd5 C T 19: 10,723,285 C285Y probably damaging Het
Chpf2 T C 5: 24,590,421 M1T probably null Het
Coch T A 12: 51,595,372 D42E probably damaging Het
Crip2 C T 12: 113,140,558 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Cxcl16 G T 11: 70,455,408 P233H probably damaging Het
Cyfip1 T C 7: 55,886,781 I319T probably damaging Het
Ddhd2 T C 8: 25,741,321 Q364R probably damaging Het
Ephx2 A G 14: 66,086,963 probably null Het
Exoc6b C A 6: 84,855,522 V397L probably damaging Het
Fam83b T A 9: 76,492,928 K298* probably null Het
Fbxo8 T A 8: 56,591,529 I289N probably damaging Het
Fkbp9 T A 6: 56,878,104 M536K probably benign Het
Flot1 C T 17: 35,825,524 R190W possibly damaging Het
Gbp2b T A 3: 142,606,978 V374E probably benign Het
Gm884 T C 11: 103,619,838 T435A unknown Het
Gna15 T A 10: 81,512,556 S114C probably damaging Het
Gstt4 T A 10: 75,817,321 T136S probably benign Het
Hcn3 C T 3: 89,148,786 V524M probably damaging Het
Kctd16 A T 18: 40,258,563 D68V probably damaging Het
Krt90 G T 15: 101,560,425 F227L possibly damaging Het
Maip1 A G 1: 57,411,835 Y212C probably damaging Het
Mamdc2 C T 19: 23,378,869 D72N probably damaging Het
Marveld3 A T 8: 109,948,483 Y234N probably damaging Het
Mas1 A G 17: 12,841,747 I263T probably benign Het
Matk T A 10: 81,258,306 probably null Het
Mrgpre T A 7: 143,781,566 I67F possibly damaging Het
Mthfd1 T A 12: 76,294,174 I449N probably damaging Het
Nacc1 C T 8: 84,676,201 R321Q probably damaging Het
Neb T C 2: 52,258,681 D2618G probably damaging Het
Neb T C 2: 52,291,268 Y1109C probably damaging Het
Nell1 T G 7: 50,856,387 W781G probably damaging Het
Olfr1037 A C 2: 86,085,584 S64R probably benign Het
Olfr1269 A G 2: 90,119,322 V92A probably benign Het
Olfr1279 T A 2: 111,306,980 Y258* probably null Het
Olfr281 T C 15: 98,457,078 L256S possibly damaging Het
Olfr424 A T 1: 174,137,415 I224F possibly damaging Het
Olfr497 C A 7: 108,422,577 A2D probably benign Het
Olfr544 T C 7: 102,484,443 I226V probably benign Het
Olfr646 T C 7: 104,106,294 L5P probably damaging Het
Pcdh7 C A 5: 57,721,315 D737E probably damaging Het
Pdss1 T G 2: 22,901,312 M55R probably benign Het
Pex6 C T 17: 46,724,700 R889W probably damaging Het
Pigl T A 11: 62,458,481 C8S possibly damaging Het
Plekha7 A T 7: 116,145,237 M585K probably damaging Het
Ppp1r1a C T 15: 103,533,087 M66I possibly damaging Het
Ptcd3 A T 6: 71,881,171 probably benign Het
Rhov A T 2: 119,271,014 V37E probably damaging Het
Rnf213 A T 11: 119,441,068 M2368L probably damaging Het
Skida1 T C 2: 18,046,157 probably benign Het
Slc25a28 T C 19: 43,666,953 D161G probably benign Het
Smc6 T C 12: 11,290,817 V490A probably damaging Het
Sohlh2 T A 3: 55,190,373 probably null Het
Stk31 A G 6: 49,417,495 T264A probably benign Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tacr1 T A 6: 82,552,901 V200E probably damaging Het
Tbrg4 C T 11: 6,620,812 R220H probably benign Het
Tcf20 A G 15: 82,852,303 L1649P probably benign Het
Tcirg1 A T 19: 3,897,866 L523Q possibly damaging Het
Tinag T A 9: 77,001,654 K335M possibly damaging Het
Tkt T G 14: 30,571,140 probably null Het
Tnpo1 C T 13: 98,863,812 R349H probably damaging Het
Trim26 T A 17: 36,852,618 S230R possibly damaging Het
Trim8 T A 19: 46,514,739 probably null Het
Trp53bp1 T C 2: 121,248,264 R326G probably null Het
Ugt2a2 A T 5: 87,460,639 I613N probably damaging Het
Vmn1r32 T C 6: 66,553,706 I29V probably benign Het
Wnt5b C T 6: 119,446,582 W27* probably null Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 unclassified probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- atttcatcttctcataatcaccatcc -3'
Posted On2013-09-03