Incidental Mutation 'R8874:Vwa3b'
ID 676446
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8874 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37035758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000125460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289] [ENSMUST00000067178] [ENSMUST00000117172] [ENSMUST00000124404] [ENSMUST00000162449]
AlphaFold A0A571BE33
Predicted Effect possibly damaging
Transcript: ENSMUST00000027289
AA Change: A2V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122
AA Change: A2V

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000069700
Gene: ENSMUSG00000050122
AA Change: A2V

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117172
AA Change: A2V

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114022
Gene: ENSMUSG00000050122
AA Change: A2V

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000124404
AA Change: A2V

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141690
Gene: ENSMUSG00000050122
AA Change: A2V

DomainStartEndE-ValueType
Blast:VWA 112 272 5e-16 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162449
AA Change: A2V

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125460
Gene: ENSMUSG00000050122
AA Change: A2V

DomainStartEndE-ValueType
Blast:VWA 112 272 7e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,825,671 M615V possibly damaging Het
Bud31 T C 5: 145,142,569 probably null Het
Ccdc42 A G 11: 68,594,570 K105E probably damaging Het
Cenpq A G 17: 40,931,660 S93P probably damaging Het
Cfh A G 1: 140,086,421 F1222L probably damaging Het
Cpxm2 A T 7: 132,106,281 probably null Het
Cubn T C 2: 13,360,346 D1627G possibly damaging Het
Diras2 T C 13: 52,507,701 E190G possibly damaging Het
Dpyd G C 3: 118,999,332 A563P probably damaging Het
Efcab8 T A 2: 153,798,649 N343K Het
Fam26d A G 10: 34,044,268 M1T probably null Het
Gbp2b A G 3: 142,608,279 E440G probably benign Het
Ghrhr T C 6: 55,378,906 F30L probably benign Het
Gm3404 T A 5: 146,528,143 V231E possibly damaging Het
Gramd4 A G 15: 86,100,892 H143R probably damaging Het
Greb1l A T 18: 10,544,896 E1408V probably benign Het
Hdgfl1 T G 13: 26,770,024 Y22S probably damaging Het
Heatr1 T A 13: 12,430,912 V1590D probably damaging Het
Hecw2 A T 1: 53,904,449 probably benign Het
Igkv8-30 C A 6: 70,117,166 R87L probably damaging Het
Il18rap T A 1: 40,525,346 C179S probably damaging Het
Jph4 T C 14: 55,114,077 T161A possibly damaging Het
Klhdc7a A T 4: 139,967,585 M17K probably damaging Het
Kpnb1 T C 11: 97,165,383 N699S probably benign Het
Lama3 T C 18: 12,449,586 probably null Het
Lca5 A G 9: 83,395,450 F614L probably damaging Het
Lyst T C 13: 13,637,562 V853A probably benign Het
Map2 A T 1: 66,416,364 T1406S probably damaging Het
Med23 A G 10: 24,895,719 I552V possibly damaging Het
Myo1h A T 5: 114,334,102 I414L Het
Myom1 A G 17: 71,106,204 K1271E probably damaging Het
Olfr126 A T 17: 37,850,784 K64M probably damaging Het
Olfr133 T A 17: 38,148,732 V48E possibly damaging Het
Olfr873 T C 9: 20,300,773 F192S possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prdm2 A T 4: 143,133,215 D1168E possibly damaging Het
Prr5 T C 15: 84,699,715 M181T probably damaging Het
Ptpdc1 A G 13: 48,590,692 I151T probably damaging Het
Ptpn7 T C 1: 135,139,266 V287A possibly damaging Het
Ptprz1 T C 6: 23,042,748 V2057A Het
Rad17 G T 13: 100,617,819 A631E probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Slc22a2 A T 17: 12,609,979 D324V probably benign Het
Ssfa2 A G 2: 79,657,340 K589R probably benign Het
Strc C T 2: 121,374,872 probably null Het
Taf4b T G 18: 14,830,070 D622E probably benign Het
Tgfbrap1 A C 1: 43,075,813 N42K probably benign Het
Uvrag A G 7: 98,979,736 F375L probably benign Het
Vmn2r76 A G 7: 86,228,791 I466T probably damaging Het
Vmn2r8 T C 5: 108,808,751 K2E probably damaging Het
Vps13d T C 4: 145,155,202 T1274A Het
Ylpm1 T C 12: 85,069,620 V2092A probably damaging Het
Zfp638 T C 6: 83,969,153 S1055P probably damaging Het
Zzef1 A G 11: 72,863,989 T982A probably benign Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGTTAGATCCCCACCCTG -3'
(R):5'- TAGAGCATCGCATCTGCCAG -3'

Sequencing Primer
(F):5'- GTTAGATCCCCACCCTGTCCTG -3'
(R):5'- CCTGACAGGTATTTGCCCGTG -3'
Posted On 2021-07-15