Incidental Mutation 'R8874:Dpyd'
ID 676456
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8874 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 118999332 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 563 (A563P)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably damaging
Transcript: ENSMUST00000039177
AA Change: A563P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: A563P

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,825,671 M615V possibly damaging Het
Bud31 T C 5: 145,142,569 probably null Het
Ccdc42 A G 11: 68,594,570 K105E probably damaging Het
Cenpq A G 17: 40,931,660 S93P probably damaging Het
Cfh A G 1: 140,086,421 F1222L probably damaging Het
Cpxm2 A T 7: 132,106,281 probably null Het
Cubn T C 2: 13,360,346 D1627G possibly damaging Het
Diras2 T C 13: 52,507,701 E190G possibly damaging Het
Efcab8 T A 2: 153,798,649 N343K Het
Fam26d A G 10: 34,044,268 M1T probably null Het
Gbp2b A G 3: 142,608,279 E440G probably benign Het
Ghrhr T C 6: 55,378,906 F30L probably benign Het
Gm3404 T A 5: 146,528,143 V231E possibly damaging Het
Gramd4 A G 15: 86,100,892 H143R probably damaging Het
Greb1l A T 18: 10,544,896 E1408V probably benign Het
Hdgfl1 T G 13: 26,770,024 Y22S probably damaging Het
Heatr1 T A 13: 12,430,912 V1590D probably damaging Het
Hecw2 A T 1: 53,904,449 probably benign Het
Igkv8-30 C A 6: 70,117,166 R87L probably damaging Het
Il18rap T A 1: 40,525,346 C179S probably damaging Het
Jph4 T C 14: 55,114,077 T161A possibly damaging Het
Klhdc7a A T 4: 139,967,585 M17K probably damaging Het
Kpnb1 T C 11: 97,165,383 N699S probably benign Het
Lama3 T C 18: 12,449,586 probably null Het
Lca5 A G 9: 83,395,450 F614L probably damaging Het
Lyst T C 13: 13,637,562 V853A probably benign Het
Map2 A T 1: 66,416,364 T1406S probably damaging Het
Med23 A G 10: 24,895,719 I552V possibly damaging Het
Myo1h A T 5: 114,334,102 I414L Het
Myom1 A G 17: 71,106,204 K1271E probably damaging Het
Olfr126 A T 17: 37,850,784 K64M probably damaging Het
Olfr133 T A 17: 38,148,732 V48E possibly damaging Het
Olfr873 T C 9: 20,300,773 F192S possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prdm2 A T 4: 143,133,215 D1168E possibly damaging Het
Prr5 T C 15: 84,699,715 M181T probably damaging Het
Ptpdc1 A G 13: 48,590,692 I151T probably damaging Het
Ptpn7 T C 1: 135,139,266 V287A possibly damaging Het
Ptprz1 T C 6: 23,042,748 V2057A Het
Rad17 G T 13: 100,617,819 A631E probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Slc22a2 A T 17: 12,609,979 D324V probably benign Het
Ssfa2 A G 2: 79,657,340 K589R probably benign Het
Strc C T 2: 121,374,872 probably null Het
Taf4b T G 18: 14,830,070 D622E probably benign Het
Tgfbrap1 A C 1: 43,075,813 N42K probably benign Het
Uvrag A G 7: 98,979,736 F375L probably benign Het
Vmn2r76 A G 7: 86,228,791 I466T probably damaging Het
Vmn2r8 T C 5: 108,808,751 K2E probably damaging Het
Vps13d T C 4: 145,155,202 T1274A Het
Vwa3b C T 1: 37,035,758 A2V possibly damaging Het
Ylpm1 T C 12: 85,069,620 V2092A probably damaging Het
Zfp638 T C 6: 83,969,153 S1055P probably damaging Het
Zzef1 A G 11: 72,863,989 T982A probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTCTTGCAGGCACAATATGGAAC -3'
(R):5'- GGGATGAGAGTGATTGTTTAAACAC -3'

Sequencing Primer
(F):5'- GGCACAATATGGAACCTCAGTGC -3'
(R):5'- TCATGTAGCCCAGACTGATAGCTG -3'
Posted On 2021-07-15