Incidental Mutation 'R8874:Gramd4'
ID 676492
Institutional Source Beutler Lab
Gene Symbol Gramd4
Ensembl Gene ENSMUSG00000035900
Gene Name GRAM domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8874 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 86057695-86137634 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86100892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 143 (H143R)
Ref Sequence ENSEMBL: ENSMUSP00000086321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]
AlphaFold Q8CB44
Predicted Effect probably damaging
Transcript: ENSMUST00000088931
AA Change: H143R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900
AA Change: H143R

DomainStartEndE-ValueType
coiled coil region 132 190 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
GRAM 500 578 8.41e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123349
AA Change: H118R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900
AA Change: H118R

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138134
AA Change: H118R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900
AA Change: H118R

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,825,671 M615V possibly damaging Het
Bud31 T C 5: 145,142,569 probably null Het
Ccdc42 A G 11: 68,594,570 K105E probably damaging Het
Cenpq A G 17: 40,931,660 S93P probably damaging Het
Cfh A G 1: 140,086,421 F1222L probably damaging Het
Cpxm2 A T 7: 132,106,281 probably null Het
Cubn T C 2: 13,360,346 D1627G possibly damaging Het
Diras2 T C 13: 52,507,701 E190G possibly damaging Het
Dpyd G C 3: 118,999,332 A563P probably damaging Het
Efcab8 T A 2: 153,798,649 N343K Het
Fam26d A G 10: 34,044,268 M1T probably null Het
Gbp2b A G 3: 142,608,279 E440G probably benign Het
Ghrhr T C 6: 55,378,906 F30L probably benign Het
Gm3404 T A 5: 146,528,143 V231E possibly damaging Het
Greb1l A T 18: 10,544,896 E1408V probably benign Het
Hdgfl1 T G 13: 26,770,024 Y22S probably damaging Het
Heatr1 T A 13: 12,430,912 V1590D probably damaging Het
Hecw2 A T 1: 53,904,449 probably benign Het
Igkv8-30 C A 6: 70,117,166 R87L probably damaging Het
Il18rap T A 1: 40,525,346 C179S probably damaging Het
Jph4 T C 14: 55,114,077 T161A possibly damaging Het
Klhdc7a A T 4: 139,967,585 M17K probably damaging Het
Kpnb1 T C 11: 97,165,383 N699S probably benign Het
Lama3 T C 18: 12,449,586 probably null Het
Lca5 A G 9: 83,395,450 F614L probably damaging Het
Lyst T C 13: 13,637,562 V853A probably benign Het
Map2 A T 1: 66,416,364 T1406S probably damaging Het
Med23 A G 10: 24,895,719 I552V possibly damaging Het
Myo1h A T 5: 114,334,102 I414L Het
Myom1 A G 17: 71,106,204 K1271E probably damaging Het
Olfr126 A T 17: 37,850,784 K64M probably damaging Het
Olfr133 T A 17: 38,148,732 V48E possibly damaging Het
Olfr873 T C 9: 20,300,773 F192S possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prdm2 A T 4: 143,133,215 D1168E possibly damaging Het
Prr5 T C 15: 84,699,715 M181T probably damaging Het
Ptpdc1 A G 13: 48,590,692 I151T probably damaging Het
Ptpn7 T C 1: 135,139,266 V287A possibly damaging Het
Ptprz1 T C 6: 23,042,748 V2057A Het
Rad17 G T 13: 100,617,819 A631E probably benign Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Slc22a2 A T 17: 12,609,979 D324V probably benign Het
Ssfa2 A G 2: 79,657,340 K589R probably benign Het
Strc C T 2: 121,374,872 probably null Het
Taf4b T G 18: 14,830,070 D622E probably benign Het
Tgfbrap1 A C 1: 43,075,813 N42K probably benign Het
Uvrag A G 7: 98,979,736 F375L probably benign Het
Vmn2r76 A G 7: 86,228,791 I466T probably damaging Het
Vmn2r8 T C 5: 108,808,751 K2E probably damaging Het
Vps13d T C 4: 145,155,202 T1274A Het
Vwa3b C T 1: 37,035,758 A2V possibly damaging Het
Ylpm1 T C 12: 85,069,620 V2092A probably damaging Het
Zfp638 T C 6: 83,969,153 S1055P probably damaging Het
Zzef1 A G 11: 72,863,989 T982A probably benign Het
Other mutations in Gramd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Gramd4 APN 15 86127018 missense probably damaging 0.97
Grasping UTSW 15 86091503 missense probably damaging 0.99
R0053:Gramd4 UTSW 15 86130138 splice site probably benign
R0622:Gramd4 UTSW 15 86091389 missense probably damaging 1.00
R1401:Gramd4 UTSW 15 86125196 missense probably damaging 1.00
R1741:Gramd4 UTSW 15 86091529 splice site probably null
R1840:Gramd4 UTSW 15 86130192 critical splice donor site probably null
R1968:Gramd4 UTSW 15 86132905 missense probably damaging 1.00
R2909:Gramd4 UTSW 15 86122183 nonsense probably null
R4345:Gramd4 UTSW 15 86134893 missense probably damaging 1.00
R4431:Gramd4 UTSW 15 86130160 missense probably damaging 1.00
R4832:Gramd4 UTSW 15 86134856 missense probably benign
R5164:Gramd4 UTSW 15 86100831 missense probably benign 0.16
R5216:Gramd4 UTSW 15 86134785 critical splice acceptor site probably null
R5898:Gramd4 UTSW 15 86100784 missense probably damaging 1.00
R5959:Gramd4 UTSW 15 86127557 missense probably damaging 0.99
R6303:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6304:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6678:Gramd4 UTSW 15 86091503 missense probably damaging 0.99
R6678:Gramd4 UTSW 15 86091504 missense possibly damaging 0.52
R6980:Gramd4 UTSW 15 86131969 missense probably benign 0.17
R7371:Gramd4 UTSW 15 86135406 missense probably benign 0.04
R7557:Gramd4 UTSW 15 86100900 nonsense probably null
R7922:Gramd4 UTSW 15 86131958 missense probably benign 0.07
R9127:Gramd4 UTSW 15 86091324 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGGAATCAGGCAAGGCTG -3'
(R):5'- CACGTTCAGAGGGAAATGTCAC -3'

Sequencing Primer
(F):5'- CAAGGCTGCTTCTGTGTGGTC -3'
(R):5'- AAGTCCATGTCTTGGTCCAAG -3'
Posted On 2021-07-15