Incidental Mutation 'R8875:0610010K14Rik'
List |< first << previous [record 57 of 543447] next >> last >|
ID676536
Institutional Source Beutler Lab
Gene Symbol 0610010K14Rik
Ensembl Gene ENSMUSG00000020831
Gene NameRIKEN cDNA 0610010K14 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8875 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70235206-70237914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70235554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 140 (V140A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021180] [ENSMUST00000021181] [ENSMUST00000040428] [ENSMUST00000100950] [ENSMUST00000102569] [ENSMUST00000108575] [ENSMUST00000108576] [ENSMUST00000108577] [ENSMUST00000108578] [ENSMUST00000108579] [ENSMUST00000125752] [ENSMUST00000141880] [ENSMUST00000176116] [ENSMUST00000176268]
Predicted Effect probably benign
Transcript: ENSMUST00000021180
SMART Domains Protein: ENSMUSP00000021180
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
Blast:SANT 38 69 1e-16 BLAST
SCOP:d1ba5__ 41 59 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021181
SMART Domains Protein: ENSMUSP00000021181
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040428
SMART Domains Protein: ENSMUSP00000048271
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100950
SMART Domains Protein: ENSMUSP00000098510
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 37 82 7.29e-1 SMART
low complexity region 105 128 N/A INTRINSIC
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102569
SMART Domains Protein: ENSMUSP00000099629
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108575
SMART Domains Protein: ENSMUSP00000104215
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108576
SMART Domains Protein: ENSMUSP00000104216
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108577
SMART Domains Protein: ENSMUSP00000104218
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108578
SMART Domains Protein: ENSMUSP00000104219
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108579
SMART Domains Protein: ENSMUSP00000104220
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125752
Predicted Effect probably benign
Transcript: ENSMUST00000134700
SMART Domains Protein: ENSMUSP00000119483
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 43 66 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134994
Gene: ENSMUSG00000020831
AA Change: V140A

DomainStartEndE-ValueType
low complexity region 29 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141880
SMART Domains Protein: ENSMUSP00000135383
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176116
SMART Domains Protein: ENSMUSP00000135134
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176268
SMART Domains Protein: ENSMUSP00000135088
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,287,642 A3178V probably benign Het
Ablim1 G T 19: 57,130,954 H233N probably benign Het
Adra1a A T 14: 66,637,765 Y63F possibly damaging Het
Aes A T 10: 81,564,700 I73F probably benign Het
Ank3 A G 10: 69,824,403 D245G unknown Het
Ap4e1 T C 2: 127,035,180 I279T probably damaging Het
Bap1 T G 14: 31,253,565 F122C probably damaging Het
Chd2 A T 7: 73,502,035 I309N probably damaging Het
Cnpy3 T C 17: 46,737,259 I177V probably damaging Het
Cp A G 3: 19,973,830 K467E possibly damaging Het
D630039A03Rik T G 4: 57,910,320 N164T probably benign Het
Dnah7a C A 1: 53,643,523 A263S probably benign Het
Eif2s1 G A 12: 78,866,687 R54Q probably damaging Het
Fasn A T 11: 120,812,398 D1600E possibly damaging Het
Fat1 T A 8: 45,040,563 F3915L probably damaging Het
Fiz1 A T 7: 5,009,094 S142T probably benign Het
Fnip1 A G 11: 54,515,554 Y1159C probably damaging Het
Fsip2 T A 2: 82,990,438 V5505D possibly damaging Het
Gabrg3 A G 7: 56,729,766 M296T probably damaging Het
Gm11562 A T 11: 99,620,351 S8T unknown Het
Gm14548 A G 7: 3,894,257 S527P probably damaging Het
Hoxd11 A G 2: 74,683,021 D210G probably benign Het
Hsd17b2 T C 8: 117,742,362 V171A possibly damaging Het
Ifi206 T C 1: 173,473,787 Y775C unknown Het
Nr2f1 A C 13: 78,189,851 I382S probably damaging Het
Nrp1 T A 8: 128,480,991 probably null Het
Olfr630 G A 7: 103,755,255 S110F probably damaging Het
Olfr652 A G 7: 104,564,463 T81A probably benign Het
Pdcd1 C T 1: 94,039,367 D269N probably benign Het
Plbd2 A G 5: 120,499,056 Y114H probably damaging Het
Plch1 A G 3: 63,710,970 C715R probably damaging Het
Plin4 G A 17: 56,104,010 A1007V probably benign Het
Prpmp5 AGGTGGGCCTTGTTGGTTACCAGGCCTAGGGTGTCCCTGTGGGCCTCCCTGTGGGGGTGG AGGTGG 6: 132,312,296 probably benign Het
Ptprs G T 17: 56,435,946 P399T probably damaging Het
Pum1 T A 4: 130,779,875 I1181N possibly damaging Het
Qrich1 A G 9: 108,559,303 probably benign Het
Rbm12 T C 2: 156,096,921 E477G probably damaging Het
Rpl7 T C 1: 16,103,529 K57R probably benign Het
Slc9a3r2 T A 17: 24,647,729 probably null Het
Stab2 C T 10: 86,996,864 C99Y probably damaging Het
Tas1r1 T A 4: 152,028,590 T669S probably benign Het
Tm2d2 T C 8: 25,017,427 L20P possibly damaging Het
Tmem158 G T 9: 123,260,067 A160E possibly damaging Het
Tpst2 T A 5: 112,309,848 Y347* probably null Het
Trpm3 T C 19: 22,910,129 I876T probably damaging Het
Ttc6 T C 12: 57,704,413 F1364L probably damaging Het
Ttc6 T A 12: 57,729,408 S1713T possibly damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Zc2hc1c T C 12: 85,289,775 S69P possibly damaging Het
Zfp982 C A 4: 147,510,863 N47K probably benign Het
Other mutations in 0610010K14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7607:0610010K14Rik UTSW 11 70237557 missense probably damaging 1.00
R8444:0610010K14Rik UTSW 11 70236929 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TAGAGTCCCAGGTGATCCACAG -3'
(R):5'- TGACCTGGTGGATGTCGAAG -3'

Sequencing Primer
(F):5'- ATCCACAGGTCCAGGGTGAAC -3'
(R):5'- TGTCGAAGGGCTAGGAGAAACTC -3'
Posted On2021-07-15