Incidental Mutation 'R8876:Col8a2'
ID 676565
Institutional Source Beutler Lab
Gene Symbol Col8a2
Ensembl Gene ENSMUSG00000056174
Gene Name collagen, type VIII, alpha 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R8876 (G1)
Quality Score 125.008
Status Validated
Chromosome 4
Chromosomal Location 126286793-126314330 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 126310854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 219 (G219A)
Ref Sequence ENSEMBL: ENSMUSP00000070270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000128435]
AlphaFold P25318
Predicted Effect probably damaging
Transcript: ENSMUST00000070132
AA Change: G219A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174
AA Change: G219A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128435
SMART Domains Protein: ENSMUSP00000123003
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 2 chain of type VIII collagen. This protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a thinner Descemet's membrane of the cornea. Mice heterozygous or homozygous for an ENU-induced mutation exhibit thin cornea, corneal epithelium, stroma, and Descemet membrane, and enlarged anterior chamber. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A G 16: 90,927,393 I164T possibly damaging Het
Accs A C 2: 93,838,058 L356R probably damaging Het
Acvr1 A T 2: 58,448,410 D433E possibly damaging Het
Aldh3b1 A G 19: 3,921,502 L122P probably damaging Het
Ap3b1 T G 13: 94,404,078 N169K possibly damaging Het
Apbb2 A G 5: 66,451,657 S216P probably benign Het
Arap3 T A 18: 37,997,024 H28L possibly damaging Het
Arhgap44 C T 11: 65,008,070 M760I possibly damaging Het
Arhgef19 G T 4: 141,247,882 A304S probably benign Het
Arntl2 G A 6: 146,821,994 G274D probably benign Het
Atpaf1 T C 4: 115,788,351 I139T possibly damaging Het
BC024139 G T 15: 76,126,120 T62K possibly damaging Het
Capn5 T C 7: 98,131,695 T292A probably benign Het
Card19 T C 13: 49,205,338 N53S possibly damaging Het
Cep97 A G 16: 55,922,104 V232A possibly damaging Het
Clca2 G T 3: 145,071,599 T837K probably benign Het
Ctu2 T C 8: 122,480,212 S365P Het
Dnah2 T C 11: 69,491,522 D1254G probably damaging Het
Dscam A G 16: 96,619,628 L1686S probably damaging Het
Fgr A G 4: 132,998,760 probably benign Het
Frmd4a T A 2: 4,601,300 S612T probably damaging Het
Gadd45gip1 T C 8: 84,834,119 I121T probably damaging Het
Gapvd1 A G 2: 34,678,548 V1353A possibly damaging Het
Gdf3 G A 6: 122,606,983 P142S probably damaging Het
Gm19965 G A 1: 116,822,046 G486R unknown Het
Gpatch2l T C 12: 86,261,631 L307P probably damaging Het
Grm3 T C 5: 9,511,580 K757E probably damaging Het
Inppl1 T A 7: 101,823,543 H1218L possibly damaging Het
Jag2 T C 12: 112,909,637 I1055V probably benign Het
Krtap9-5 G T 11: 99,949,514 C347F unknown Het
Magi2 T A 5: 20,651,192 Y1050* probably null Het
Myrf A G 19: 10,229,014 probably benign Het
Ntpcr T G 8: 125,738,046 probably benign Het
Olfr1386 T C 11: 49,470,559 M136T probably damaging Het
Olfr404-ps1 C T 11: 74,240,020 T152I probably damaging Het
Olfr525 T C 7: 140,322,803 Y35H probably damaging Het
Palmd T G 3: 116,927,250 D145A probably damaging Het
Pdcd1 A G 1: 94,052,430 S21P probably benign Het
Pkn1 T C 8: 83,672,250 T696A possibly damaging Het
Pnpt1 T A 11: 29,146,769 probably benign Het
Sbf2 T A 7: 110,449,939 I273F probably damaging Het
Slc16a4 A T 3: 107,300,785 N204Y probably benign Het
Slc38a1 T C 15: 96,616,210 I44V possibly damaging Het
Smpdl3a T C 10: 57,809,070 V312A probably damaging Het
Ston1 A G 17: 88,635,172 Y2C probably benign Het
Syde1 A T 10: 78,589,491 Y229N probably damaging Het
Ttc37 T G 13: 76,175,284 D1382E probably benign Het
Ttc6 T A 12: 57,737,703 C1853S possibly damaging Het
Ttn A G 2: 76,778,905 I17650T possibly damaging Het
Upf1 T C 8: 70,344,268 E105G possibly damaging Het
Wrn A G 8: 33,324,394 W341R probably benign Het
Xndc1 C T 7: 102,080,547 P267L probably benign Het
Zbtb26 T C 2: 37,436,884 T47A probably benign Het
Zc3h10 A T 10: 128,544,294 V398E probably damaging Het
Zfp652 G T 11: 95,749,095 probably benign Het
Other mutations in Col8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col8a2 APN 4 126309791 missense probably damaging 0.99
IGL01776:Col8a2 APN 4 126309805 unclassified probably benign
IGL03367:Col8a2 APN 4 126312198 missense probably damaging 1.00
R1861:Col8a2 UTSW 4 126311624 unclassified probably benign
R1909:Col8a2 UTSW 4 126312133 missense possibly damaging 0.63
R2038:Col8a2 UTSW 4 126311315 unclassified probably benign
R2866:Col8a2 UTSW 4 126311199 unclassified probably benign
R4013:Col8a2 UTSW 4 126311115 unclassified probably benign
R4586:Col8a2 UTSW 4 126311019 unclassified probably benign
R4995:Col8a2 UTSW 4 126310788 missense probably damaging 0.98
R5160:Col8a2 UTSW 4 126310412 missense possibly damaging 0.77
R5574:Col8a2 UTSW 4 126311268 unclassified probably benign
R5858:Col8a2 UTSW 4 126311300 unclassified probably benign
R6803:Col8a2 UTSW 4 126312000 missense probably damaging 1.00
Z1177:Col8a2 UTSW 4 126311543 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTCCCTCAGGTATTACTGTC -3'
(R):5'- TGGCATCCCATAGCCAACAG -3'

Sequencing Primer
(F):5'- GGTATTACTGTCCCTGGAAAACCAG -3'
(R):5'- TAGCCCCTACTGGACCCTGTG -3'
Posted On 2021-07-15